View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_low_22 (Length: 263)
Name: NF4732_low_22
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 64 - 253
Target Start/End: Complemental strand, 5718853 - 5718664
Alignment:
| Q |
64 |
tgatgattcgatggcttcggatgcttcgtccggtccaatgaattatcaacatcaaacaaattatggtcgcggacaaggaaagtcggggttgaagaaagat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5718853 |
tgatgattcgatggcttcggatgcttcgtccggtccaatgaattatcaacatcaaacaaattatggtcgcggacaaggaaagtcggggttgaagaaagat |
5718754 |
T |
 |
| Q |
164 |
aagcaagatcatggaagcaaaagttgttctaagaagaatggaaacaaacaagagaagaaacgtgttgatagtagaagtaaaaaatgatga |
253 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5718753 |
aaacaagatcatggaagcaagagttgttctaagaagaatggaaacaaacaagagaagaaacgtgttgatagtagaagtaaaaaatgatga |
5718664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University