View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_low_28 (Length: 238)
Name: NF4732_low_28
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 1387605 - 1387817
Alignment:
| Q |
11 |
cctcggcacttaagtgctaaagaactcatatcaaatttnnnnnnnnnntattatactatgctatgctatcttcacatatctactagaaaaactatggtaa |
110 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1387605 |
cctcggcacttaattgccaaagaactcatatcaaattttaaaaaaaaatattatactatgctatgctatcttcacacatctactagaaaaactatggtaa |
1387704 |
T |
 |
| Q |
111 |
aactttgattcttgtgtggcatgctgaaatgccactatgcattctcttaattatggcactatgctgaaacgggattatgcattctcttaattaccaagtc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1387705 |
aactttgattcttgtgtggcatgctgaaatgccactatgcattctcttaattatggcactatgctgaaacgggattatgcattctcttaattaccaagtc |
1387804 |
T |
 |
| Q |
211 |
taaccaactaatt |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1387805 |
taaccaactaatt |
1387817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 79 - 223
Target Start/End: Original strand, 40187011 - 40187155
Alignment:
| Q |
79 |
tcttcacatatctactagaaaaactatggtaaaactttgattcttgtgtggcatgctgaaatgccactatgcattctcttaattatggcactatgctgaa |
178 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187011 |
tcttcacacatctactagaaaaactatgctaaaattttgattcttgagtggcatgctgaaatggcactatgcattctcttaattatggcactatgctgaa |
40187110 |
T |
 |
| Q |
179 |
acgggattatgcattctcttaattaccaagtctaaccaactaatt |
223 |
Q |
| |
|
||||| |||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
40187111 |
acggggttatacattctcttaatcaccaagtctagccaactaatt |
40187155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 36346445 - 36346482
Alignment:
| Q |
96 |
gaaaaactatggtaaaactttgattcttgtgtggcatg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36346445 |
gaaaaactatggtaaaactttgattcttgtgtgacatg |
36346482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 48
Target Start/End: Complemental strand, 1388075 - 1388038
Alignment:
| Q |
11 |
cctcggcacttaagtgctaaagaactcatatcaaattt |
48 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1388075 |
cctcggcacttaagtgccgaagaactcatatcaaattt |
1388038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 59 - 223
Target Start/End: Complemental strand, 26945177 - 26945025
Alignment:
| Q |
59 |
tattatactatgctatgctatcttcacatatctactagaaaaactatggtaaaactttgattcttgtgtggcatgctgaaatgccactatgcattctctt |
158 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
26945177 |
tattatac-atgctatgctatcttcacacatctactagaaaaactatggtaaaactttgattcttgtgtggc-----------ccactatgcattatctt |
26945090 |
T |
 |
| Q |
159 |
aattatggcactatgctgaaacgggattatgcattctcttaattaccaagtctaaccaactaatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
26945089 |
aattatggcactatgctgaaacgggattatgcattctcttaatcaccaagtctagccaactaatt |
26945025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University