View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4732_low_29 (Length: 237)

Name: NF4732_low_29
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4732_low_29
NF4732_low_29
[»] chr8 (2 HSPs)
chr8 (1-223)||(36410249-36410471)
chr8 (59-223)||(36394055-36394218)
[»] chr3 (1 HSPs)
chr3 (1-53)||(52094897-52094949)


Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36410471 - 36410249
Alignment:
1 tttctcatctgtttgtaattgttggttggttagaaattagtttgtgttggttatacataaatgtgggaagtagagtatctttgtggtggagcagaattcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36410471 tttctcatctgtttgtaattgttggttggttagaaattagtttgtgttggttatacataaatgtgggaagtagagtatctttgtggtggagcagaattcg 36410372  T
101 ggtaggcgcatgtagagtgattgctggtgccgttacttccattacacataacgttggtgttttcaccaccaggaacaatggctttggaaacccgttgcag 200  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     
36410371 ggtaggcgcatgtagagtgattgctggtgccgttactcccattacacataacgttggtgttttcgccaccaggaacaatggctttggaaacccgttgcaa 36410272  T
201 atctccttttctcagtatcaaat 223  Q
    |||||||||||||||||||||||    
36410271 atctccttttctcagtatcaaat 36410249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 59 - 223
Target Start/End: Original strand, 36394055 - 36394218
Alignment:
59 aaatgtgggaagtagagtatctttgtggtggagcagaattcgggtaggcgcatgtagagtgattgctggtgccgttacttccattacacataacgttggt 158  Q
    ||||||||||||||||| | ||||| |||||||||| |||||| ||||||||||||| ||||| ||||| |||  |   ||||||||||||||||||| |    
36394055 aaatgtgggaagtagaggaactttgcggtggagcagtattcgg-taggcgcatgtagtgtgatcgctggcgccactgtgtccattacacataacgttgat 36394153  T
159 gttttcaccaccaggaacaatggctttggaaacccgttgcagatctccttttctcagtatcaaat 223  Q
    |||||| | | |||||||||||||||| || | |||||||||||||| |||||||| || |||||    
36394154 gttttctcgagcaggaacaatggctttagacatccgttgcagatctctttttctcaataccaaat 36394218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 52094949 - 52094897
Alignment:
1 tttctcatctgtttgtaattgttggttggttagaaattagtttgtgttggtta 53  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
52094949 tttctcatctgtttgtaattgttggttagttagaaattagtttgtgttagtta 52094897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University