View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_low_32 (Length: 219)
Name: NF4732_low_32
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_low_32 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 6 - 219
Target Start/End: Original strand, 29165257 - 29165470
Alignment:
| Q |
6 |
aatatacagttagaaataacatatacaggataattatgatagtacagtatcatgtaaatatagcaaataaggtaatgtttatctttttataattgtatat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29165257 |
aatatacagttagaaataacatatacagtataattatgatagtacagtatcatgtaaatatagcaaataaggtaatgtttatctttttataattgtatat |
29165356 |
T |
 |
| Q |
106 |
attgtgacacacacaaaattgagctctgtgttagacactggattcgctcaggcccctaattcaaggaatgccagccctcgactctcactatcacaatcct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29165357 |
attgtgacacacacaaaattgagctctgtgatagacactggattcgctcaggcccctaattcaaggaatgccagccctcgactctcactatcacaatcct |
29165456 |
T |
 |
| Q |
206 |
ttttatttttattt |
219 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
29165457 |
ttttaattttattt |
29165470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University