View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_low_36 (Length: 206)
Name: NF4732_low_36
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 10 - 174
Target Start/End: Original strand, 31482075 - 31482239
Alignment:
| Q |
10 |
caatgagattacctttggtagagatgcaaaacgggtaagatgaaccgtgcaaacggcaagcaaaccgaatcgaggtaaaattggagaagcgaagattata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
31482075 |
caatgagattacctttggtagagatgcaaaacgggtaagatgaaccgtgcaaacggcgagcaaaccgaatcgaggtaaaattgcagaagtgaagattata |
31482174 |
T |
|
| Q |
110 |
ttgataaaaagaatggaaacaaagaggataatttctcattgttcaatgtatagtgtaaaactgat |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31482175 |
ttgataaaaagaatggaaacaaagaggataatttctcattgttcaatgtatagtgtagaactgat |
31482239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University