View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4733_high_5 (Length: 259)
Name: NF4733_high_5
Description: NF4733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4733_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 37062366 - 37062596
Alignment:
| Q |
11 |
cagagagcaccggaagccgaagctcaggggtgggcctcagtgggcctttagcatccaaaaaacaacgaaaccgaagcaagaacaaaagtgcaagcttcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062366 |
cagagagcaccggaagccgaagctcaggggtgggcctcagtgggcctttagcatccaaaaaacaacgaaaccgaagcaagaacaaaagtgcaagcttcaa |
37062465 |
T |
|
| Q |
111 |
ggacgatggtgaaatggtggagataacattgaacgtacgtgatgactccgtttccgttcagaatattcgcggtggagacactgaaaccgcgtttctggca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37062466 |
ggacgatggtgaaatggtggagataacattgaacgtacgtgatgactccgtttccgttcagaatattcgcggtggagacactgaaacggcgtttctggca |
37062565 |
T |
|
| Q |
211 |
agccagcttgagaagcgtccatcgtcgcttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37062566 |
agccagcttgagaagcgtccatcgtcgcttt |
37062596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University