View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4733_high_6 (Length: 240)
Name: NF4733_high_6
Description: NF4733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4733_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 25968812 - 25969021
Alignment:
| Q |
20 |
ctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggcgtaaacggggcagagatacttttggtgtcggtaaacctcctcttaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25968812 |
ctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggtgtaaacggggcagagatacttttggtgtcggtaaacctcctcttaga |
25968911 |
T |
 |
| Q |
120 |
gtaattaaactggcgaaaatttcttgtgaatcggttgatcttcaatgaatctttccgattttcaaatgtgtctgcattgttgttgcgtctcttgggtatg |
219 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25968912 |
gtagttaaactggcgaaaatttcttgtgaatcggttggtcttcaatgaatctttccgattttcaaatgtatctgcattgttgttgcgtctcttgggtatg |
25969011 |
T |
 |
| Q |
220 |
tctctgctcc |
229 |
Q |
| |
|
| |||||||| |
|
|
| T |
25969012 |
tttctgctcc |
25969021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University