View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4733_high_6 (Length: 240)

Name: NF4733_high_6
Description: NF4733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4733_high_6
NF4733_high_6
[»] chr2 (1 HSPs)
chr2 (20-229)||(25968812-25969021)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 25968812 - 25969021
Alignment:
20 ctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggcgtaaacggggcagagatacttttggtgtcggtaaacctcctcttaga 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
25968812 ctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggtgtaaacggggcagagatacttttggtgtcggtaaacctcctcttaga 25968911  T
120 gtaattaaactggcgaaaatttcttgtgaatcggttgatcttcaatgaatctttccgattttcaaatgtgtctgcattgttgttgcgtctcttgggtatg 219  Q
    ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
25968912 gtagttaaactggcgaaaatttcttgtgaatcggttggtcttcaatgaatctttccgattttcaaatgtatctgcattgttgttgcgtctcttgggtatg 25969011  T
220 tctctgctcc 229  Q
    | ||||||||    
25969012 tttctgctcc 25969021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University