View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4733_low_2 (Length: 394)
Name: NF4733_low_2
Description: NF4733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4733_low_2 |
 | |
|
| [»] scaffold0049 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 168 - 385
Target Start/End: Original strand, 33185869 - 33186079
Alignment:
| Q |
168 |
atttgcaagttgggtttgtgggaaaaccaatagtagtgtgtttgcactatttatggtagccatggcccatttgggttggctcatccctttcaagttatgc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33185869 |
atttgcaagttgggtttgtgggaaaaccagtagtagtgtggttgcactatatatggtagccatg-------tgggttggctcatccctttcaagttatgc |
33185961 |
T |
|
| Q |
268 |
accacttccccaaggtgctctgttgactctcatctatatctccattaagctgcaatctgaccaaatataaagaacatgcctctgctagcatttcttactt |
367 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
33185962 |
accaattccccaaggtgctctgttaactctcatctacatgtccattaagctgcaatctgaccaaatataaagaccatgcttctgccagcatttcttactt |
33186061 |
T |
|
| Q |
368 |
ctgaatttggatgatgtc |
385 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
33186062 |
ctgaatttgtatgatgtc |
33186079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 77 - 151
Target Start/End: Complemental strand, 9493 - 9419
Alignment:
| Q |
77 |
tgtaggtttattgatcaatttaaggatattaaatcagctactatttcaaagtcttcacgattatttgttggtgtt |
151 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
9493 |
tgtaggcttattaatcaatttaaggatattaaatcaactactatttcaaagtcttcatgattattagttgttgtt |
9419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University