View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4733_low_4 (Length: 361)

Name: NF4733_low_4
Description: NF4733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4733_low_4
NF4733_low_4
[»] chr2 (1 HSPs)
chr2 (88-212)||(7307890-7308014)
[»] chr6 (2 HSPs)
chr6 (177-226)||(13245530-13245579)
chr6 (316-354)||(13245400-13245438)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 88 - 212
Target Start/End: Complemental strand, 7308014 - 7307890
Alignment:
88 atcaatcttttattatggaaatggtgattgagtaattcgaagttgtcatgttgcctctattatgaatagtgttaggatcctcgtatgtgtatggtaagtt 187  Q
    ||||| |||||||| | |||||||||||||||||| |||||||||||   |||||||| |||||||| ||||| ||||||| |||||||||||||  |||    
7308014 atcaagcttttattgtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgtatggttggtt 7307915  T
188 gagattacggtttttggttggattt 212  Q
    |||||| |||||||||||| |||||    
7307914 gagattgcggtttttggtttgattt 7307890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 13245579 - 13245530
Alignment:
177 tatggtaagttgagattacggtttttggttggatttagctggtttttgag 226  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||    
13245579 tatggtaagttgagattacggtttttggttcgatttagctggtttttgag 13245530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 316 - 354
Target Start/End: Complemental strand, 13245438 - 13245400
Alignment:
316 ccatccctgtatttgtggggttagtcttaattccctatg 354  Q
    |||||||||| ||||||||||||||||||||||||||||    
13245438 ccatccctgtgtttgtggggttagtcttaattccctatg 13245400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University