View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4734-Insertion-15 (Length: 248)
Name: NF4734-Insertion-15
Description: NF4734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4734-Insertion-15 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 50 - 248
Target Start/End: Original strand, 53675181 - 53675376
Alignment:
| Q |
50 |
atgtgttgcattccccctatccaataacaaaacattattttttcctcaattttattgatgatggagacacatatatacttgtatgatttgattcacgtgt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675181 |
atgtgttgcattccccctatccaataacaaaacattattttttccccaattttattgatgatggagacacatatatacttgtatgatttgattcacgtgt |
53675280 |
T |
 |
| Q |
150 |
gtttgaaattaattacctgtttggaccaacaacaagtctgtgcaaattctccaagcacagatataacatatgcttttgcttgcctaagttgtgattgtc |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675281 |
gtttgaaattaattacctgtttggac---caacaagtctgtgcaaattctccaagcacagatataacatatgcttttgcttgcctaagttgtgattgtc |
53675376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 53675087 - 53675128
Alignment:
| Q |
8 |
gttttttgcggactaatcagaaggaatgcaaatcacgtaaac |
49 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53675087 |
gttttttgcagactaatcagaaggaatgcaaatcacgtaaac |
53675128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University