View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4734-Insertion-16 (Length: 183)
Name: NF4734-Insertion-16
Description: NF4734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4734-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 6591123 - 6590952
Alignment:
| Q |
12 |
cataacacaatcggtaataccaacattgttaggatagatatcttttatggtgtctcgatttaaacttgaaatcttccgcattgtgtgcgtataagtttat |
111 |
Q |
| |
|
|||| |||||||| ||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6591123 |
catagcacaatcgataataccaacattattagggtagatatcttttatgctgtctcgatttaaacttgaaatcttccgcattgtgtgcgtataagtttat |
6591024 |
T |
|
| Q |
112 |
agtagtgttgtcactttgcctgcaagcccaaaaagcatactcttaaattatgatttcccattttctatgtga |
183 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6591023 |
agtagtgttgtcactttgccagcaaacccaaaaaacatactcttaaattatgatttcccattttctatgtga |
6590952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University