View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4734_low_10 (Length: 274)
Name: NF4734_low_10
Description: NF4734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4734_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 220
Target Start/End: Complemental strand, 16910459 - 16910263
Alignment:
| Q |
24 |
gagacagaactgaaaacacaaattgattataattcggtaagccacgagcgaatactgaattattcaatgcaagagtcgtgactcttcgccaaagtgtctt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16910459 |
gagacagaactgaaaacacaaattgattataattgggtaagccacgagcgaatactgaattattcaatgcaagagtagtgactcttcgccaaagtgtctt |
16910360 |
T |
 |
| Q |
124 |
ccatctagtagacaatacacaagtttgaacaacttgttttgtgtccataaacttcatcatattgagcaaaacagaatcacacaagtcactaagccgg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910359 |
ccatctagtagacaatacacaagtttgaacaacttgttttgtgtccataaacttcattatattgagcaaaacagaatcacacaagtcactaagccgg |
16910263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University