View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4734_low_14 (Length: 237)
Name: NF4734_low_14
Description: NF4734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4734_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 3400853 - 3401051
Alignment:
| Q |
20 |
ccataagctgtattttctaacgtttgttttttgaaggagggaaggtcttgaaaggcaagttatgaaatttcacaaggaagctaagtagtccttattcata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3400853 |
ccataagctgtattttctaacgtttgttttttgaaggagtgaaggtcttgaaaggcaagttatgaaatttcacaaggaagctaagtagtccttattcata |
3400952 |
T |
 |
| Q |
120 |
ttttatttcaaacgtcaattcaatgtttcaaaaggaatattgattannnnnnngtgggaacaaggaatattgattattggcatgcagttgaacaatgcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3400953 |
ttttatttcaaacgtcaattcaatgtttcaaaaggaatattgattatttttttgagggaacaaggaatattgattattggcatgcagttgaacaatgcg |
3401051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University