View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4735_high_6 (Length: 232)
Name: NF4735_high_6
Description: NF4735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4735_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 26196111 - 26196333
Alignment:
| Q |
1 |
agtcatcccatgtttggactatccctaaaatccaagatagtgggatgttccaaaatcaagatcgaaatggctcaagaaagatgatgctaacacacaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26196111 |
agtcatcccatgtttggactctccctaaaatccaagatagtgggatgttccaaaatcaagatcgaaatggctcaaaaaagatgatgctaacacacaaaaa |
26196210 |
T |
 |
| Q |
101 |
tccatgcttgtgttaattgtagaaagagagcaaatgcaactgtgggacttaaaagacttaaaaagggggagaagtggttggagggtttggtagaggtgca |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26196211 |
tccatgcttgtgttaatagtagaaagagagcaaatgcaactgtgg---------gacttaaaaaaggggagaagtggttggagggtttggtagaggtgca |
26196301 |
T |
 |
| Q |
201 |
gaaggagatatttagctattttgcaaatcact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26196302 |
gaaggagatatttagctattttgcaaatcact |
26196333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University