View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4735_low_7 (Length: 237)
Name: NF4735_low_7
Description: NF4735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4735_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 45361368 - 45361153
Alignment:
| Q |
11 |
tattttattaagctagcacatttattttcacggatattctggtcaaaggacacaaattcttcaaactacatacaactgtaacataacaaacaaaagataa |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361368 |
tattttattaagctaacacatttattttcacggatattctggtcaaaggacacaaattcttcaaactacatacaactgtaacataacaaacaaaagataa |
45361269 |
T |
 |
| Q |
111 |
acaaattatttaaaaaatcccacttgaattgggaaaaggacaaaataaaccattttcagtggatgctgatgctgaattgaaagggggagactccagataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
45361268 |
acaaattatttaaaaaatcccacttgaattgggaaaaggacaaaataaaccattttgaatgga--gttatgctgaattgaaagggggagactccagataa |
45361171 |
T |
 |
| Q |
211 |
atgtagacaaatgatgat |
228 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
45361170 |
atgtagagaaatgatgat |
45361153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University