View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4736-Insertion-10 (Length: 353)
Name: NF4736-Insertion-10
Description: NF4736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4736-Insertion-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 80 - 209
Target Start/End: Complemental strand, 17998739 - 17998610
Alignment:
| Q |
80 |
atttaactcacataagcctatcaatcacaagagtctactgaatgcacaaataattaaggtagataattaattattcacgtaaacaacatttttcttttat |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17998739 |
atttaactcacataagcccatcaatcacaagagtctactgaatgcacaaataattaaggtagataattaattattcacgtaaagaacatttttcttttat |
17998640 |
T |
 |
| Q |
180 |
cttcaactgttagcaatgctctaggtgtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17998639 |
cttcaactgttagcaatgctctaggtgtct |
17998610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 237 - 290
Target Start/End: Complemental strand, 17998644 - 17998591
Alignment:
| Q |
237 |
tttatcttcaactgttagcaatgctctaggtgtctctttccttagggcgtaata |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17998644 |
tttatcttcaactgttagcaatgctctaggtgtctctttccttagggcgtaata |
17998591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University