View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4736-Insertion-16 (Length: 240)
Name: NF4736-Insertion-16
Description: NF4736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4736-Insertion-16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 65 - 240
Target Start/End: Complemental strand, 36078482 - 36078307
Alignment:
| Q |
65 |
gtgggagaagtatattattaatacttaacccacctatcgataaagtatatgttatttatactgtgttttgacttagtttggaggctttgccgacccacat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36078482 |
gtgggagaagtatattattaatacttaacccacctatcgataaagtatatgttatttatactgtgttttgacttagtttggaggctttgccgacccacat |
36078383 |
T |
 |
| Q |
165 |
accgagttagtgtcatcgagaaagaatcaattccctatctcggctactctagcatcgcctaaccttcaataaattg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36078382 |
accgagttagtgtcatcgagaaagaatcaattccttatctcggctactctagcatcgcctaaccttcaataaattg |
36078307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University