View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4736_high_15 (Length: 250)
Name: NF4736_high_15
Description: NF4736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4736_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 32724675 - 32724461
Alignment:
| Q |
1 |
ttccgccatggtagtcgcgttattgcacggaagtggtagttgcactatttctggaattaattttaaaaaacagatagaaggaatgaacgtagtggtgaaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| | |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724675 |
ttccgccatggtagtcgtgttattgcacggaagtggaagtcgaactatttctgaaattaattt-aaaaaacagatagaaggaatgaacgtagtggtgaaa |
32724577 |
T |
 |
| Q |
101 |
gtaaatgttatattatgaatattattcatgaatgaattttgaaagagaaagatattaaaattaaaatttagaaacatacttggcaatgtcttctttcctc |
200 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
32724576 |
gtaaatgttgtatcatgaatattattcatgaaagaattttgaaaga-aacgatattaaaattaaaatttagaaacatacttggcaatg-attttttcctc |
32724479 |
T |
 |
| Q |
201 |
ttctgtaagtgatttcac |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32724478 |
ttctgtaagtgatttcac |
32724461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 98 - 218
Target Start/End: Complemental strand, 4001937 - 4001817
Alignment:
| Q |
98 |
aaagtaaatgttatattatgaatattattcatgaatgaattttgaaagagaaagatattaaaattaaaatttagaaacatacttggcaatgtcttctttc |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4001937 |
aaagtaaatgttgtattatgaatattattcatgaatgaattttgaaagagaaagatattaaaattaaaatttagaaacatacttggcattgtcttctttc |
4001838 |
T |
 |
| Q |
198 |
ctcttctgtaagtgatttcac |
218 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
4001837 |
ctcttatgtaagtgatttcac |
4001817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University