View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4736_high_17 (Length: 237)
Name: NF4736_high_17
Description: NF4736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4736_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 109 - 222
Target Start/End: Complemental strand, 44045440 - 44045327
Alignment:
| Q |
109 |
ctcttattcacatttgacataccaacaaagtgagtgtgtggggtgagtggtaattcaatgattgccaaccttatgataagagtttaatgcatttttgtgg |
208 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44045440 |
ctcttattcacatttcaaataccaacaaagtgagtgtgtggggtgagtggtaattcaatgattgccaaccttatgataagagtttaatgcatttttgtgg |
44045341 |
T |
 |
| Q |
209 |
acaagagggagaag |
222 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
44045340 |
acaagaaggagaag |
44045327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University