View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4737-Insertion-10 (Length: 93)
Name: NF4737-Insertion-10
Description: NF4737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4737-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0115 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 2530943 - 2530993
Alignment:
| Q |
43 |
gaaagcaagtatttgtgttccatttatgatatgttgtggttggtgcattgg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2530943 |
gaaagcaagtatttgtgttccatttatgctatgttgtggttggtgcattgg |
2530993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 43 - 93
Target Start/End: Original strand, 9470167 - 9470217
Alignment:
| Q |
43 |
gaaagcaagtatttgtgttccatttatgatatgttgtggttggtgcattgg |
93 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9470167 |
gaaagcaagtgtttgtgttccatttatgatatgttgtggttggtgcattgg |
9470217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115 (Bit Score: 44; Significance: 1e-16; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 39020 - 38973
Alignment:
| Q |
43 |
gaaagcaagtatttgtgttccatttatgatatgttgtggttggtgcat |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39020 |
gaaagcaagtatttgtgttccatttatgctatgttgtggttggtgcat |
38973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University