View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4737-Insertion-17 (Length: 64)
Name: NF4737-Insertion-17
Description: NF4737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4737-Insertion-17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 5e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 7098724 - 7098679
Alignment:
| Q |
8 |
gcaatcattgtgaacggttttcatcacttggtaaactaccatatct |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7098724 |
gcaatcattgtgaacggttttcatcacttggtaaactaccatatct |
7098679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 7582530 - 7582563
Alignment:
| Q |
16 |
tgtgaacggttttcatcacttggtaaactaccat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7582530 |
tgtgaacggttttcatcacttggtaaactaccat |
7582563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 17982220 - 17982186
Alignment:
| Q |
15 |
ttgtgaacggttttcatcacttggtaaactaccat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17982220 |
ttgtgaacggttttcatcacttggtaaactaccat |
17982186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 13615908 - 13615872
Alignment:
| Q |
13 |
cattgtgaacggttttcatcacttggtaaactaccat |
49 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13615908 |
cattgagaacggttttcatcacttggtaaactaccat |
13615872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University