View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4737_low_3 (Length: 251)
Name: NF4737_low_3
Description: NF4737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4737_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 43612307 - 43612084
Alignment:
| Q |
19 |
agtatctgttgcctcagagtcacaagaacaagtgaggcagagtgaaaaccccaacaacaagaaaaactccaagnnnnnnnnnnnnnnnnnnnnagaag-- |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43612307 |
agtatctgttgcctcagagtcacaagaacaagtgaggcagagtgaaaaccccaacaacaagaaaaactccaaggatgatgatgatgatgatgatgaagaa |
43612208 |
T |
 |
| Q |
117 |
-tgggaatttctaaaatacaagtgcctagacagaaacacatccctgtttccaagtctctgcttctagatgcaatcctctctaacatgcttcatcaagata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612207 |
gtgggaatttctaaaatacaagtgcctagacagaaacacatccctgtttccaagtcccagcttctagatgcaatcctctctaacatgcttcatcaagata |
43612108 |
T |
 |
| Q |
216 |
ctgctcatcactttcgccttctca |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43612107 |
ctgctcatcactttcgccttctca |
43612084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University