View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4738-Insertion-7 (Length: 83)
Name: NF4738-Insertion-7
Description: NF4738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4738-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 7 - 83
Target Start/End: Complemental strand, 8407410 - 8407334
Alignment:
| Q |
7 |
ataactatctaagtggttttgattatacgatgttaatctaaatttaagatacctttaaagcaagtttcttcatcttg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8407410 |
ataactatctaagtggttttgattatacgatgttaatctaaatttaagacacctttaaagcaagtttcttcatcttg |
8407334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University