View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4739-Insertion-6 (Length: 165)
Name: NF4739-Insertion-6
Description: NF4739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4739-Insertion-6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 1e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 6326824 - 6326978
Alignment:
| Q |
8 |
ctagcttgcctcgtcggtatggtaatcatcttaaggtataccctagttggcacaggttcgagtcctagcaaacagggttgtgtttggattgaaatgatca |
107 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326824 |
ctagctcgccttgtcggtatggtaatcatcttaaggtataccctagttggcacaggttcgagtcctagcaaacagggttgtgtttggattgaaatgatca |
6326923 |
T |
 |
| Q |
108 |
ataaatatgaggtattataaaatacctctctttttggttgtaaagattccattac |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
6326924 |
ataaatatgaggtattataaaatacctctcttttttgttgcagagattccattac |
6326978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 141
Target Start/End: Original strand, 6337453 - 6337481
Alignment:
| Q |
113 |
tatgaggtattataaaatacctctctttt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6337453 |
tatgaggtattataaaatacctctctttt |
6337481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University