View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4739-Insertion-7 (Length: 244)
Name: NF4739-Insertion-7
Description: NF4739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4739-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 49411567 - 49411324
Alignment:
| Q |
12 |
aaacaaaaatcaagcatgcaaacccgaaaccacataatgtaaatagttagaaatcacaaaatgattaagattatgagtgctttggctaataatatgatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411567 |
aaacaaaaatcaagcatgcaaacccgaaaccacataatgtaaatagctagaaatcacaaaatgattaagattatgagtgctttggctaataatatgatat |
49411468 |
T |
 |
| Q |
112 |
tttatcttccttcaacgtcaatttata-----------gcatcatccctagcttccttctaaaagcatctctcatctccaacgatgctatcaccaaaccc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411467 |
tttatcttccttcaacatcaatttatagcattatctttgcatcatccctagcttccttctaaaagcatctctcatctccaacgatgctatcaccaaaccc |
49411368 |
T |
 |
| Q |
201 |
actttctcttttatgtgcactacttctatgcttacccctagcca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411367 |
actttctcttttatgtgcactacttctatgcttacccctagcca |
49411324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University