View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4740-Insertion-11 (Length: 271)
Name: NF4740-Insertion-11
Description: NF4740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4740-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 271
Target Start/End: Complemental strand, 46796319 - 46796054
Alignment:
| Q |
8 |
aatggtccatagcagcattcataatttcagagagatgtgccagaagaagaacctttgttggctcttttctacaaggnnnnnnnnn--tcagttcttagca |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46796319 |
aatggtccatagcatcattcataatttcagagagatgtgccagaagaagaacctttgttggctcttttctacaaggaaaaaaaaaaatcagttcttagca |
46796220 |
T |
 |
| Q |
106 |
tgaccttaaaatcaatattcaactgccttatnnnnnnntgatgtgcaacactgcataaaccatcatccactcaacctacctgttctgccacttttgttgc |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46796219 |
tgaccttgaaatcaatattcaactgccttataaaaaaatgatgtgcaacactgcataaaccatcatccactcaacctacctgttctgccacttttgttgc |
46796120 |
T |
 |
| Q |
206 |
tgctgactcaagcagttgaccccccacaatgtgtagcatacttcgtaacacagtatgcctgggtat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46796119 |
tgctgactcaagcagttgaccccccacaatgtgtagcatacttcgtaacacagtatgcctgggtat |
46796054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University