View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4741_high_10 (Length: 372)

Name: NF4741_high_10
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4741_high_10
NF4741_high_10
[»] chr1 (3 HSPs)
chr1 (283-372)||(9906567-9906661)
chr1 (283-372)||(18703778-18703870)
chr1 (249-286)||(18703882-18703919)
[»] chr7 (2 HSPs)
chr7 (283-370)||(7734612-7734696)
chr7 (283-325)||(41831942-41831984)
[»] chr5 (2 HSPs)
chr5 (283-368)||(35305376-35305463)
chr5 (249-286)||(21255907-21255944)
[»] chr8 (3 HSPs)
chr8 (283-320)||(29865087-29865124)
chr8 (283-325)||(7275901-7275943)
chr8 (283-325)||(26174760-26174802)
[»] scaffold1412 (1 HSPs)
scaffold1412 (283-325)||(542-584)
[»] scaffold0001 (1 HSPs)
scaffold0001 (283-325)||(145401-145443)
[»] chr6 (1 HSPs)
chr6 (283-325)||(6823813-6823855)
[»] chr2 (3 HSPs)
chr2 (283-325)||(31270221-31270263)
chr2 (255-286)||(24038752-24038783)
chr2 (284-325)||(24038796-24038837)
[»] scaffold0525 (1 HSPs)
scaffold0525 (283-325)||(6682-6724)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 283 - 372
Target Start/End: Complemental strand, 9906661 - 9906567
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggctccttgtttctttgtttgttg-----acatgccctgtagtttaccggttgcat 372  Q
    |||||||||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||     |||||||||||||| ||| ||||||||    
T  9906661 atggtttgaagacatatcacatggctatgcatctccattggctccttgtttttttttttgttgctgttacatgccctgtagtatacaggttgcat 9906567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 283 - 372
Target Start/End: Complemental strand, 18703870 - 18703778
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggctccttgtttct-ttgt--ttgttgacatgccctgtagtttaccggttgcat 372  Q
    |||||||||||||||||||||||||||||| |||| ||||||||||||||| | ||||  |||||||||||||||||||  ||| ||||||||    
T  18703870 atggtttgaagacacatcacatggctatgcatctctattggctccttgtttttgttgttgttgttgacatgccctgtagcatacaggttgcat 18703778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 286
Target Start/End: Complemental strand, 18703919 - 18703882
Alignment:
Q  249 cattgattttgacctatggtttgaatgcatcaacatgg 286  Q
    ||||| ||||| ||||||||||||||||||||||||||    
T  18703919 cattggttttggcctatggtttgaatgcatcaacatgg 18703882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 283 - 370
Target Start/End: Original strand, 7734612 - 7734696
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggctccttgtttctttgtttgttgacatgccctgtagtttaccggttgc 370  Q
    |||||||||||||||||||||||||||||| |||||||||| ||    ||| ||| ||| ||||||||||||||||||||| ||||||    
T  7734612 atggtttgaagacacatcacatggctatgcatctccattggatc---tttttttttttttttgacatgccctgtagtttacaggttgc 7734696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 325
Target Start/End: Original strand, 41831942 - 41831984
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    ||||||||||||||| |||||||||||||| |||| |||||||    
T  41831942 atggtttgaagacacctcacatggctatgcatctctattggct 41831984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 368
Target Start/End: Complemental strand, 35305463 - 35305376
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggctccttgtttctttgtt--tgttgacatgccctgtagtttaccggtt 368  Q
    |||||||||||||||||  ||||||||||| |||| |||||||| |||||  ||||||  ||||||||||||||||||||||| ||||    
T  35305463 atggtttgaagacacattgcatggctatgcatctctattggctcattgttcttttgttgctgttgacatgccctgtagtttacaggtt 35305376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 286
Target Start/End: Original strand, 21255907 - 21255944
Alignment:
Q  249 cattgattttgacctatggtttgaatgcatcaacatgg 286  Q
    ||||| ||||| ||||||||||||||||||||||||||    
T  21255907 cattggttttggcctatggtttgaatgcatcaacatgg 21255944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 320
Target Start/End: Complemental strand, 29865124 - 29865087
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccat 320  Q
    ||||||||||||||||||||||||||||||||||||||    
T  29865124 atggtttgaagacacatcacatggctatgcctctccat 29865087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 7275943 - 7275901
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    ||||||||||||||| |||||||||||||| |||| |||||||    
T  7275943 atggtttgaagacacctcacatggctatgcatctctattggct 7275901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 325
Target Start/End: Original strand, 26174760 - 26174802
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||| ||||||||||||||| |||| |||||||    
T  26174760 atggtttgaagacatatcacatggctatgcatctctattggct 26174802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1412 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1412
Description:

Target: scaffold1412; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 584 - 542
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||||||||||||||||||| |||| |||||||    
T  584 atggtttgaagacacatcacatggctatgcatctctattggct 542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 145443 - 145401
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||||||||||||||||||| |||| |||||||    
T  145443 atggtttgaagacacatcacatggctatgcatctctattggct 145401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 6823855 - 6823813
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||||||||||||||||||| |||| |||||||    
T  6823855 atggtttgaagacacatcacatggctatgcatctctattggct 6823813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 31270263 - 31270221
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||||||||||||||||||| |||| |||||||    
T  31270263 atggtttgaagacacatcacatggctatgcatctcgattggct 31270221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 255 - 286
Target Start/End: Original strand, 24038752 - 24038783
Alignment:
Q  255 ttttgacctatggtttgaatgcatcaacatgg 286  Q
    ||||||||||||||||||||||||||||||||    
T  24038752 ttttgacctatggtttgaatgcatcaacatgg 24038783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 325
Target Start/End: Original strand, 24038796 - 24038837
Alignment:
Q  284 tggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    |||||||||||||| |||||||||||||| |||| |||||||    
T  24038796 tggtttgaagacacctcacatggctatgcatctctattggct 24038837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0525 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0525
Description:

Target: scaffold0525; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 325
Target Start/End: Complemental strand, 6724 - 6682
Alignment:
Q  283 atggtttgaagacacatcacatggctatgcctctccattggct 325  Q
    ||||||||||||||| |||||||||||||| |||| |||||||    
T  6724 atggtttgaagacacctcacatggctatgcatctctattggct 6682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University