View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4741_high_21 (Length: 241)
Name: NF4741_high_21
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4741_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 22 - 238
Target Start/End: Complemental strand, 29449908 - 29449692
Alignment:
| Q |
22 |
gctacggagctaccttcactccgttactttttgactatatttataataggacattgacatgcatcctattattgttaagtgcaaaccttaattttagttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29449908 |
gctacggagctaccttcactccgttactttttgactatatttataatagtacattgacatgcatcctattattgttaagtgtaaaccttaattttagttt |
29449809 |
T |
 |
| Q |
122 |
gaaaattatcactttttctttcatttagtctcatgtacaaatgtcataaaaagtcttaaactattctcaatccatcaatcgtttatgggtttacctaatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449808 |
gaaaattatcactttttctttcatttagtctcatgtacaaatgtcataaaaagtcttaaactattctcaatccatcaatcgtttatgggtttacctaatg |
29449709 |
T |
 |
| Q |
222 |
tagatcttgtcacagat |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29449708 |
tagatcttgtcacagat |
29449692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University