View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4741_low_14 (Length: 303)
Name: NF4741_low_14
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4741_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 76 - 262
Target Start/End: Original strand, 6733745 - 6733931
Alignment:
| Q |
76 |
actgaaggttttggttcaaagaaattttaataactttttgagataatggaagcaaatacattcttccttaagtgtttgttttcaataggaaaatatatga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6733745 |
actgaaggttttggttcaaagaaattttaataactttttgagataatggaagcaaatatattcttccttaagtgtttgttttcaataggaaaatatatga |
6733844 |
T |
 |
| Q |
176 |
aactaagcaaacctttcgtttgattccagttctataaactatctaaacaccaatatatgatctttgaagttaatatgcttttggacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6733845 |
aactaagcaaacctttcgtttgattccatttctataaactatctaaacaccaatatatgatctttgaagttaatatgcttttggacc |
6733931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University