View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4741_low_19 (Length: 253)
Name: NF4741_low_19
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4741_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 23471849 - 23472036
Alignment:
| Q |
1 |
aaaatagaattgcatgaattaatagatgt-caaatttgtagcagaaagtaggcagatttgccatatcctcctaaagataagtttgaatgcacttttcacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23471849 |
aaaatagaattgcatgaattaatagatgtacaaatttgtagcagaaagtaggcagatttgccatatcctccaaaagataagtttgaatgcacttttcac- |
23471947 |
T |
 |
| Q |
100 |
tctctctcaagtattgtgtttgtgcaatttggtccctcccnnnnnnnnnagcagctctattctctttggttttctttttagaagtctattatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23471948 |
---ctctcaagtattgtgtttgtgcaatttggtccctccc-ttttttttagcagctctattctctttggttttctttttagaagtctattatt |
23472036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 204 - 237
Target Start/End: Original strand, 23472035 - 23472068
Alignment:
| Q |
204 |
ttttgtggttcaatgatattttaacgatattatc |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
23472035 |
ttttgtggtttaatgatattttaacgatattatc |
23472068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University