View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4741_low_2 (Length: 599)

Name: NF4741_low_2
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4741_low_2
NF4741_low_2
[»] chr3 (126 HSPs)
chr3 (288-580)||(6792357-6792647)
chr3 (135-256)||(35038191-35038312)
chr3 (137-256)||(16239557-16239676)
chr3 (139-255)||(11589752-11589868)
chr3 (137-255)||(35038427-35038545)
chr3 (137-255)||(54567859-54567977)
chr3 (143-256)||(20327619-20327732)
chr3 (139-255)||(9272928-9273044)
chr3 (139-255)||(20327850-20327966)
chr3 (137-256)||(54368482-54368601)
chr3 (137-255)||(1723075-1723192)
chr3 (137-255)||(22729067-22729185)
chr3 (137-256)||(8018934-8019053)
chr3 (137-256)||(39620292-39620411)
chr3 (137-255)||(4155291-4155409)
chr3 (137-255)||(16926948-16927066)
chr3 (146-255)||(38791458-38791567)
chr3 (136-256)||(4155525-4155645)
chr3 (136-256)||(16239793-16239913)
chr3 (136-256)||(31317432-31317552)
chr3 (137-255)||(12930127-12930245)
chr3 (137-256)||(20303063-20303182)
chr3 (137-248)||(45138970-45139081)
chr3 (137-255)||(7697397-7697514)
chr3 (137-255)||(17638202-17638319)
chr3 (137-234)||(472059-472156)
chr3 (143-256)||(9273161-9273274)
chr3 (137-257)||(3975357-3975477)
chr3 (143-255)||(6487338-6487450)
chr3 (139-255)||(17001422-17001538)
chr3 (137-257)||(18757807-18757927)
chr3 (144-255)||(27670398-27670509)
chr3 (137-243)||(50083079-50083186)
chr3 (137-255)||(31317196-31317313)
chr3 (141-243)||(45138805-45138907)
chr3 (293-475)||(6786389-6786569)
chr3 (137-257)||(39269296-39269416)
chr3 (137-255)||(34610527-34610646)
chr3 (162-256)||(23691216-23691310)
chr3 (162-256)||(23708016-23708110)
chr3 (162-256)||(23726472-23726566)
chr3 (162-256)||(23744928-23745022)
chr3 (162-256)||(24063453-24063547)
chr3 (139-256)||(39683268-39683386)
chr3 (138-251)||(45828217-45828330)
chr3 (137-256)||(4008651-4008770)
chr3 (137-256)||(23708223-23708342)
chr3 (137-256)||(23726679-23726798)
chr3 (137-256)||(23745135-23745254)
chr3 (139-217)||(13574922-13575000)
chr3 (139-228)||(50052540-50052630)
chr3 (143-256)||(49629572-49629684)
chr3 (137-236)||(43781569-43781668)
chr3 (135-256)||(17638374-17638492)
chr3 (137-251)||(30179707-30179821)
chr3 (143-235)||(13741106-13741199)
chr3 (137-255)||(28087214-28087336)
chr3 (137-214)||(45828027-45828104)
chr3 (148-236)||(1800201-1800289)
chr3 (1-72)||(6786667-6786738)
chr3 (140-251)||(13574686-13574797)
chr3 (137-200)||(24866219-24866282)
chr3 (135-230)||(33205457-33205552)
chr3 (137-223)||(24063660-24063746)
chr3 (180-253)||(54368691-54368764)
chr3 (135-251)||(2806283-2806399)
chr3 (509-573)||(6799575-6799639)
chr3 (137-253)||(21809146-21809262)
chr3 (137-255)||(27086554-27086675)
chr3 (140-251)||(33640253-33640362)
chr3 (196-255)||(34992517-34992576)
chr3 (154-255)||(23610387-23610488)
chr3 (137-223)||(23691423-23691509)
chr3 (178-240)||(30138046-30138108)
chr3 (178-240)||(30147597-30147659)
chr3 (148-229)||(20479001-20479082)
chr3 (137-192)||(26272323-26272378)
chr3 (161-255)||(2123774-2123868)
chr3 (137-251)||(41915142-41915255)
chr3 (161-243)||(50930681-50930763)
chr3 (157-248)||(2805336-2805428)
chr3 (137-253)||(29575889-29576005)
chr3 (139-251)||(50052773-50052879)
chr3 (150-204)||(14611194-14611248)
chr3 (137-255)||(14839736-14839854)
chr3 (149-251)||(20264289-20264390)
chr3 (137-191)||(33640076-33640130)
chr3 (173-255)||(35018678-35018760)
chr3 (137-222)||(8142407-8142491)
chr3 (139-188)||(20303386-20303435)
chr3 (139-200)||(47702410-47702471)
chr3 (149-249)||(22775409-22775509)
chr3 (137-223)||(37246666-37246749)
chr3 (137-256)||(8142646-8142765)
chr3 (198-257)||(19954278-19954337)
chr3 (140-191)||(23607613-23607663)
chr3 (136-191)||(24475925-24475980)
chr3 (143-194)||(32215520-32215571)
chr3 (161-256)||(52724009-52724104)
chr3 (169-252)||(52994748-52994831)
chr3 (159-241)||(1681686-1681768)
chr3 (139-192)||(1353478-1353531)
chr3 (515-580)||(13354418-13354483)
chr3 (163-232)||(13740888-13740957)
chr3 (214-255)||(20303013-20303054)
chr3 (139-256)||(29215590-29215707)
chr3 (204-256)||(34992807-34992860)
chr3 (137-217)||(21717348-21717428)
chr3 (137-217)||(42420829-42420909)
chr3 (202-242)||(46794034-46794074)
chr3 (143-230)||(8487518-8487604)
chr3 (139-194)||(11590033-11590088)
chr3 (149-228)||(17001253-17001332)
chr3 (136-231)||(44576253-44576348)
chr3 (182-256)||(47684498-47684572)
chr3 (157-214)||(272433-272490)
chr3 (191-236)||(1800023-1800068)
chr3 (137-170)||(27086693-27086726)
chr3 (196-225)||(27783060-27783089)
chr3 (137-230)||(29215814-29215906)
chr3 (137-214)||(35018483-35018560)
chr3 (137-218)||(40765700-40765781)
chr3 (137-210)||(46794246-46794319)
chr3 (139-171)||(21833399-21833431)
chr3 (152-255)||(29089816-29089920)
chr3 (137-189)||(46854057-46854109)
[»] chr4 (135 HSPs)
chr4 (137-256)||(39902562-39902681)
chr4 (139-256)||(28245527-28245644)
chr4 (137-257)||(35788859-35788979)
chr4 (134-256)||(21498761-21498883)
chr4 (137-251)||(22827509-22827623)
chr4 (137-255)||(22863441-22863559)
chr4 (137-255)||(35788626-35788744)
chr4 (137-255)||(50543566-50543684)
chr4 (136-255)||(21684965-21685084)
chr4 (137-255)||(22845446-22845564)
chr4 (137-255)||(53828522-53828640)
chr4 (139-255)||(21498321-21498437)
chr4 (136-256)||(53828287-53828407)
chr4 (137-256)||(22231072-22231191)
chr4 (137-256)||(50543329-50543448)
chr4 (137-255)||(11036745-11036863)
chr4 (150-255)||(9279194-9279299)
chr4 (139-256)||(20821939-20822056)
chr4 (137-256)||(35796741-35796860)
chr4 (139-255)||(25052819-25052935)
chr4 (139-255)||(53814930-53815046)
chr4 (137-256)||(22231307-22231426)
chr4 (137-255)||(1518131-1518249)
chr4 (139-257)||(9685597-9685715)
chr4 (137-255)||(52559534-52559652)
chr4 (139-255)||(400566-400682)
chr4 (139-255)||(5846113-5846229)
chr4 (137-253)||(37836049-37836165)
chr4 (137-256)||(6218405-6218524)
chr4 (154-257)||(27634097-27634200)
chr4 (137-256)||(35796976-35797095)
chr4 (136-251)||(44118857-44118972)
chr4 (137-255)||(35819127-35819245)
chr4 (139-255)||(9685365-9685481)
chr4 (139-255)||(14783188-14783304)
chr4 (137-253)||(35175004-35175119)
chr4 (139-255)||(54054806-54054922)
chr4 (137-256)||(11036510-11036629)
chr4 (152-255)||(35645779-35645882)
chr4 (137-256)||(40717440-40717559)
chr4 (137-251)||(6218175-6218289)
chr4 (154-256)||(31254423-31254525)
chr4 (137-257)||(18528216-18528336)
chr4 (171-255)||(27634549-27634633)
chr4 (136-256)||(35609488-35609608)
chr4 (139-239)||(53814675-53814775)
chr4 (137-256)||(5398475-5398593)
chr4 (137-256)||(12869028-12869147)
chr4 (139-234)||(16066053-16066148)
chr4 (137-256)||(17111734-17111853)
chr4 (139-225)||(2463803-2463889)
chr4 (135-256)||(52559770-52559891)
chr4 (136-207)||(53559288-53559359)
chr4 (137-251)||(7926529-7926643)
chr4 (137-219)||(28073180-28073262)
chr4 (171-256)||(5846345-5846430)
chr4 (162-251)||(27464272-27464361)
chr4 (138-256)||(45784870-45784996)
chr4 (148-256)||(5398222-5398329)
chr4 (137-256)||(2516167-2516284)
chr4 (137-228)||(12869262-12869353)
chr4 (137-224)||(34358029-34358116)
chr4 (137-228)||(4464286-4464380)
chr4 (171-255)||(13555500-13555584)
chr4 (139-254)||(2261754-2261869)
chr4 (163-222)||(28246110-28246169)
chr4 (137-256)||(36685874-36685992)
chr4 (149-243)||(7926307-7926401)
chr4 (137-215)||(35609710-35609788)
chr4 (137-231)||(50870480-50870573)
chr4 (143-256)||(21750047-21750160)
chr4 (149-248)||(20253484-20253584)
chr4 (137-209)||(40726734-40726806)
chr4 (139-255)||(54055039-54055149)
chr4 (180-255)||(980092-980167)
chr4 (170-256)||(7806613-7806699)
chr4 (137-255)||(17111531-17111648)
chr4 (137-255)||(18528456-18528574)
chr4 (137-251)||(41187931-41188045)
chr4 (139-256)||(11103897-11104014)
chr4 (139-243)||(26549615-26549720)
chr4 (158-251)||(53698998-53699091)
chr4 (136-253)||(10361997-10362116)
chr4 (151-251)||(12005482-12005582)
chr4 (137-255)||(22445415-22445537)
chr4 (148-252)||(30566044-30566148)
chr4 (137-232)||(6666634-6666729)
chr4 (137-216)||(22822356-22822435)
chr4 (139-210)||(24513361-24513431)
chr4 (158-255)||(6778681-6778779)
chr4 (137-215)||(25323797-25323875)
chr4 (136-257)||(13555245-13555366)
chr4 (151-228)||(35485221-35485298)
chr4 (171-243)||(2221001-2221073)
chr4 (139-243)||(13637368-13637472)
chr4 (161-237)||(25324056-25324132)
chr4 (154-213)||(17222668-17222727)
chr4 (136-255)||(20095259-20095378)
chr4 (157-256)||(42662429-42662528)
chr4 (148-230)||(8902619-8902701)
chr4 (157-255)||(11783811-11783909)
chr4 (137-215)||(42684792-42684870)
chr4 (158-215)||(6666220-6666277)
chr4 (137-230)||(21646264-21646357)
chr4 (135-256)||(30565806-30565927)
chr4 (148-189)||(40716480-40716521)
chr4 (187-256)||(40717255-40717324)
chr4 (148-252)||(13611759-13611863)
chr4 (137-217)||(23209846-23209926)
chr4 (139-231)||(1333508-1333602)
chr4 (156-231)||(50858999-50859073)
chr4 (137-251)||(21041322-21041436)
chr4 (137-223)||(21646500-21646586)
chr4 (137-215)||(50828207-50828285)
chr4 (134-251)||(41037019-41037136)
chr4 (154-194)||(22867147-22867187)
chr4 (149-217)||(30529937-30530005)
chr4 (161-201)||(52146088-52146128)
chr4 (164-231)||(7572728-7572795)
chr4 (165-228)||(7892542-7892605)
chr4 (139-210)||(24513140-24513211)
chr4 (137-192)||(28501618-28501673)
chr4 (149-200)||(40716632-40716683)
chr4 (139-194)||(41743136-41743191)
chr4 (206-256)||(6778511-6778561)
chr4 (151-217)||(11056345-11056411)
chr4 (136-214)||(32002565-32002642)
chr4 (180-250)||(40965041-40965111)
chr4 (161-215)||(48052815-48052869)
chr4 (156-193)||(4455563-4455600)
chr4 (137-210)||(23210069-23210142)
chr4 (184-249)||(32333956-32334021)
chr4 (166-214)||(20726631-20726679)
chr4 (137-189)||(31039346-31039397)
chr4 (137-213)||(43742998-43743074)
[»] scaffold0519 (2 HSPs)
scaffold0519 (136-256)||(2117-2237)
scaffold0519 (137-255)||(1883-2001)
[»] chr6 (98 HSPs)
chr6 (136-256)||(4868575-4868695)
chr6 (137-255)||(13353168-13353286)
chr6 (137-255)||(33494506-33494624)
chr6 (137-255)||(33796293-33796411)
chr6 (137-255)||(4868812-4868930)
chr6 (137-255)||(9704987-9705105)
chr6 (137-256)||(9705220-9705339)
chr6 (137-256)||(17147659-17147778)
chr6 (139-258)||(21690686-21690805)
chr6 (139-257)||(27656423-27656541)
chr6 (136-256)||(19712918-19713038)
chr6 (139-257)||(8026354-8026472)
chr6 (135-253)||(25065091-25065209)
chr6 (139-240)||(12330180-12330281)
chr6 (139-253)||(30256782-30256895)
chr6 (139-255)||(12330292-12330407)
chr6 (139-255)||(27653184-27653300)
chr6 (139-255)||(27772681-27772797)
chr6 (137-256)||(6054369-6054488)
chr6 (137-255)||(6542942-6543060)
chr6 (139-256)||(27772912-27773029)
chr6 (139-255)||(8566960-8567075)
chr6 (142-249)||(16722811-16722918)
chr6 (137-255)||(3679979-3680097)
chr6 (135-256)||(2736164-2736285)
chr6 (148-257)||(6400630-6400739)
chr6 (143-256)||(12329949-12330062)
chr6 (140-256)||(5572386-5572502)
chr6 (137-255)||(7915817-7915934)
chr6 (137-253)||(13740885-13741001)
chr6 (137-253)||(13746385-13746501)
chr6 (139-255)||(24554084-24554200)
chr6 (137-252)||(11721875-11721990)
chr6 (137-256)||(19639112-19639231)
chr6 (149-255)||(2753225-2753331)
chr6 (137-255)||(11085548-11085666)
chr6 (153-255)||(28867972-28868074)
chr6 (138-256)||(30256544-30256662)
chr6 (139-256)||(15081909-15082026)
chr6 (137-256)||(6542708-6542826)
chr6 (137-214)||(19712722-19712801)
chr6 (137-242)||(3713322-3713427)
chr6 (139-256)||(5572617-5572733)
chr6 (166-255)||(6400874-6400963)
chr6 (139-255)||(2736403-2736519)
chr6 (137-252)||(12199803-12199919)
chr6 (137-236)||(16570145-16570244)
chr6 (137-214)||(8001549-8001626)
chr6 (139-204)||(8026622-8026687)
chr6 (181-257)||(3680211-3680287)
chr6 (155-255)||(21214952-21215052)
chr6 (148-255)||(2737180-2737287)
chr6 (137-207)||(6623409-6623479)
chr6 (161-255)||(15600903-15600997)
chr6 (182-256)||(31961144-31961218)
chr6 (159-256)||(33494740-33494838)
chr6 (135-256)||(6065941-6066062)
chr6 (149-241)||(33631816-33631907)
chr6 (137-256)||(5648671-5648790)
chr6 (137-256)||(10145749-10145868)
chr6 (171-257)||(30505702-30505789)
chr6 (157-251)||(3823275-3823369)
chr6 (182-256)||(7638634-7638708)
chr6 (137-255)||(11085780-11085898)
chr6 (158-255)||(4906773-4906870)
chr6 (178-255)||(6237742-6237819)
chr6 (139-228)||(13740675-13740764)
chr6 (139-228)||(13746175-13746264)
chr6 (139-255)||(12885021-12885140)
chr6 (137-209)||(20373584-20373655)
chr6 (139-254)||(15082145-15082259)
chr6 (137-256)||(24554316-24554434)
chr6 (137-252)||(30849401-30849516)
chr6 (171-248)||(15102964-15103041)
chr6 (205-256)||(13353402-13353453)
chr6 (205-256)||(33796527-33796578)
chr6 (149-215)||(7333093-7333159)
chr6 (173-251)||(12319709-12319787)
chr6 (137-231)||(32290719-32290813)
chr6 (137-217)||(4161845-4161926)
chr6 (137-217)||(4223465-4223546)
chr6 (214-255)||(30505470-30505511)
chr6 (187-255)||(6369431-6369499)
chr6 (141-256)||(32290929-32291043)
chr6 (137-255)||(6054136-6054254)
chr6 (181-255)||(12199728-12199802)
chr6 (158-212)||(20830760-20830814)
chr6 (137-254)||(1788948-1789064)
chr6 (136-220)||(7638846-7638930)
chr6 (159-214)||(20661060-20661114)
chr6 (179-225)||(1788778-1788824)
chr6 (170-252)||(10145547-10145629)
chr6 (178-223)||(1788715-1788760)
chr6 (151-248)||(3823608-3823705)
chr6 (210-255)||(19648306-19648351)
chr6 (172-224)||(467609-467661)
chr6 (159-207)||(12319913-12319961)
chr6 (165-217)||(33631638-33631690)
[»] chr8 (136 HSPs)
chr8 (137-256)||(11232193-11232312)
chr8 (137-255)||(24532420-24532538)
chr8 (137-255)||(39052928-39053046)
chr8 (137-255)||(11232428-11232546)
chr8 (135-256)||(5931946-5932067)
chr8 (139-256)||(19256587-19256704)
chr8 (136-257)||(35682779-35682900)
chr8 (139-256)||(39743495-39743612)
chr8 (137-257)||(39960156-39960277)
chr8 (139-256)||(17477031-17477148)
chr8 (136-256)||(15042668-15042788)
chr8 (139-255)||(17469785-17469901)
chr8 (139-255)||(19256821-19256937)
chr8 (139-255)||(24075307-24075423)
chr8 (137-255)||(42846604-42846723)
chr8 (137-255)||(10449967-10450085)
chr8 (137-255)||(12317013-12317131)
chr8 (139-255)||(5590369-5590485)
chr8 (139-255)||(7267466-7267582)
chr8 (140-251)||(4828264-4828375)
chr8 (137-248)||(5932183-5932294)
chr8 (137-251)||(37001435-37001549)
chr8 (138-242)||(8928997-8929101)
chr8 (137-255)||(3157558-3157677)
chr8 (137-256)||(20301227-20301346)
chr8 (137-256)||(21087859-21087978)
chr8 (136-251)||(22638177-22638292)
chr8 (136-255)||(25325613-25325732)
chr8 (137-256)||(3157326-3157442)
chr8 (153-243)||(38447442-38447532)
chr8 (139-256)||(422218-422335)
chr8 (139-256)||(28069358-28069475)
chr8 (136-255)||(35385809-35385929)
chr8 (137-251)||(18939296-18939409)
chr8 (139-251)||(4828039-4828151)
chr8 (137-257)||(18004095-18004215)
chr8 (139-255)||(34842645-34842761)
chr8 (137-257)||(41790624-41790743)
chr8 (137-256)||(12547065-12547183)
chr8 (137-252)||(12688277-12688392)
chr8 (140-250)||(26800514-26800624)
chr8 (137-255)||(36917438-36917556)
chr8 (137-256)||(3157008-3157127)
chr8 (137-227)||(10884059-10884149)
chr8 (158-256)||(34843083-34843181)
chr8 (137-231)||(37001217-37001311)
chr8 (139-256)||(28213105-28213221)
chr8 (135-211)||(27204975-27205051)
chr8 (135-211)||(27205073-27205149)
chr8 (137-248)||(8084101-8084212)
chr8 (137-256)||(8084328-8084447)
chr8 (136-231)||(38476268-38476363)
chr8 (159-254)||(39984782-39984877)
chr8 (137-211)||(27205171-27205245)
chr8 (137-215)||(38475754-38475832)
chr8 (154-251)||(7729912-7730009)
chr8 (139-240)||(8716096-8716197)
chr8 (139-256)||(34653117-34653233)
chr8 (139-255)||(16049996-16050112)
chr8 (137-257)||(31197812-31197932)
chr8 (153-256)||(16050227-16050329)
chr8 (136-236)||(20301487-20301593)
chr8 (137-232)||(20515134-20515229)
chr8 (136-236)||(21088119-21088225)
chr8 (143-254)||(29099745-29099856)
chr8 (137-243)||(29005843-29005949)
chr8 (182-256)||(39052581-39052655)
chr8 (137-251)||(42049686-42049800)
chr8 (137-221)||(15042885-15042969)
chr8 (138-241)||(20094795-20094897)
chr8 (136-251)||(30201522-30201637)
chr8 (135-256)||(6541880-6542002)
chr8 (137-251)||(8466723-8466837)
chr8 (158-255)||(20702763-20702861)
chr8 (149-255)||(31197582-31197688)
chr8 (137-251)||(36907427-36907541)
chr8 (137-228)||(422452-422543)
chr8 (157-256)||(5675753-5675852)
chr8 (141-243)||(4873694-4873795)
chr8 (137-251)||(10614938-10615052)
chr8 (181-251)||(29907769-29907839)
chr8 (137-251)||(37868582-37868696)
chr8 (139-192)||(4963384-4963437)
chr8 (151-232)||(27439560-27439641)
chr8 (182-243)||(34236692-34236753)
chr8 (137-209)||(41790882-41790955)
chr8 (160-251)||(5940029-5940120)
chr8 (137-243)||(6462938-6463043)
chr8 (137-223)||(12688071-12688157)
chr8 (182-256)||(20094604-20094678)
chr8 (137-224)||(42584672-42584755)
chr8 (168-228)||(7669635-7669695)
chr8 (136-220)||(15797049-15797132)
chr8 (137-217)||(40014663-40014743)
chr8 (171-251)||(44931215-44931295)
chr8 (150-214)||(45031373-45031437)
chr8 (148-231)||(6559459-6559542)
chr8 (156-255)||(7669386-7669485)
chr8 (138-217)||(15686040-15686119)
chr8 (137-251)||(28213319-28213434)
chr8 (169-251)||(37868379-37868461)
chr8 (137-194)||(10454454-10454511)
chr8 (137-214)||(16962245-16962322)
chr8 (139-192)||(26208013-26208066)
chr8 (149-226)||(30953015-30953086)
chr8 (137-228)||(26482675-26482764)
chr8 (165-251)||(3961426-3961512)
chr8 (181-255)||(4873500-4873574)
chr8 (165-251)||(6463163-6463249)
chr8 (148-253)||(8715871-8715977)
chr8 (202-256)||(19472314-19472368)
chr8 (202-256)||(19543239-19543293)
chr8 (202-256)||(19589403-19589457)
chr8 (214-256)||(39052770-39052812)
chr8 (182-243)||(8466532-8466593)
chr8 (135-176)||(24532283-24532324)
chr8 (137-214)||(26208248-26208325)
chr8 (150-219)||(30966079-30966148)
chr8 (135-223)||(36917253-36917342)
chr8 (137-186)||(38476074-38476123)
chr8 (136-185)||(44694707-44694756)
chr8 (149-194)||(45122373-45122418)
chr8 (137-201)||(10615155-10615219)
chr8 (179-251)||(31079603-31079675)
chr8 (169-229)||(37868103-37868163)
chr8 (152-251)||(12022402-12022501)
chr8 (134-217)||(16962077-16962160)
chr8 (137-255)||(5676055-5676173)
chr8 (152-186)||(25940795-25940829)
chr8 (148-214)||(31079809-31079875)
chr8 (169-215)||(37867863-37867909)
chr8 (198-243)||(7729694-7729739)
chr8 (137-217)||(10615635-10615716)
chr8 (165-214)||(31079365-31079414)
chr8 (206-255)||(44354023-44354071)
chr8 (171-255)||(13051440-13051524)
[»] chr7 (125 HSPs)
chr7 (137-256)||(21861495-21861614)
chr7 (137-255)||(21054952-21055070)
chr7 (137-255)||(47710410-47710528)
chr7 (137-255)||(47722066-47722184)
chr7 (140-256)||(3392948-3393064)
chr7 (139-255)||(29469572-29469688)
chr7 (137-256)||(36277225-36277344)
chr7 (137-255)||(21861261-21861379)
chr7 (139-256)||(29469806-29469923)
chr7 (139-256)||(34027359-34027476)
chr7 (135-256)||(43688157-43688277)
chr7 (139-256)||(26562074-26562191)
chr7 (137-256)||(26239915-26240034)
chr7 (140-254)||(44874348-44874462)
chr7 (137-258)||(6634819-6634940)
chr7 (136-256)||(48243059-48243177)
chr7 (143-255)||(2544452-2544564)
chr7 (136-256)||(34027593-34027713)
chr7 (137-256)||(1596794-1596913)
chr7 (137-224)||(25620134-25620221)
chr7 (137-255)||(1596561-1596678)
chr7 (137-255)||(3038083-3038201)
chr7 (143-255)||(17202146-17202258)
chr7 (137-253)||(33996310-33996426)
chr7 (139-243)||(40746244-40746348)
chr7 (139-255)||(48661556-48661672)
chr7 (137-256)||(2404173-2404292)
chr7 (137-256)||(18826487-18826606)
chr7 (135-256)||(31892353-31892474)
chr7 (137-253)||(21821775-21821891)
chr7 (137-256)||(40746032-40746151)
chr7 (143-257)||(2544220-2544334)
chr7 (138-256)||(6001435-6001553)
chr7 (137-255)||(42985122-42985240)
chr7 (149-255)||(48243448-48243554)
chr7 (137-249)||(32879613-32879726)
chr7 (139-256)||(40746464-40746581)
chr7 (137-256)||(4268020-4268140)
chr7 (143-251)||(11211684-11211791)
chr7 (139-255)||(31257268-31257384)
chr7 (141-256)||(3519733-3519843)
chr7 (137-256)||(22574802-22574920)
chr7 (137-256)||(36993073-36993192)
chr7 (139-255)||(10903051-10903168)
chr7 (142-243)||(32278889-32278990)
chr7 (137-229)||(31485658-31485750)
chr7 (139-255)||(36206064-36206180)
chr7 (140-251)||(23839079-23839190)
chr7 (152-255)||(31892118-31892221)
chr7 (137-255)||(2404407-2404525)
chr7 (139-233)||(10882007-10882100)
chr7 (139-253)||(31257032-31257146)
chr7 (137-255)||(5522846-5522966)
chr7 (134-243)||(15317532-15317640)
chr7 (149-254)||(26028972-26029077)
chr7 (155-256)||(31485441-31485542)
chr7 (135-255)||(43085534-43085655)
chr7 (137-241)||(4886310-4886414)
chr7 (137-251)||(1793719-1793831)
chr7 (141-243)||(3520042-3520145)
chr7 (137-256)||(14540740-14540859)
chr7 (139-250)||(20305664-20305775)
chr7 (136-256)||(21822005-21822129)
chr7 (135-254)||(33996076-33996195)
chr7 (137-255)||(28080632-28080749)
chr7 (149-242)||(23796195-23796288)
chr7 (135-255)||(43075307-43075428)
chr7 (159-255)||(46452599-46452696)
chr7 (171-255)||(9689123-9689207)
chr7 (136-207)||(32474515-32474586)
chr7 (137-256)||(36276990-36277109)
chr7 (148-243)||(47849550-47849645)
chr7 (137-256)||(4267820-4267941)
chr7 (143-255)||(14540957-14541068)
chr7 (135-215)||(30727115-30727195)
chr7 (137-217)||(40898714-40898794)
chr7 (153-256)||(25620337-25620440)
chr7 (149-251)||(32292489-32292591)
chr7 (165-256)||(35308173-35308264)
chr7 (137-211)||(1000560-1000634)
chr7 (139-221)||(1793921-1794003)
chr7 (149-243)||(23796034-23796127)
chr7 (143-243)||(2401339-2401439)
chr7 (135-255)||(41190981-41191101)
chr7 (160-255)||(43089230-43089326)
chr7 (148-251)||(47849763-47849864)
chr7 (171-230)||(4454768-4454827)
chr7 (141-256)||(4507131-4507246)
chr7 (168-255)||(22574572-22574659)
chr7 (150-254)||(33834394-33834490)
chr7 (141-232)||(48417518-48417609)
chr7 (136-214)||(23794354-23794432)
chr7 (137-243)||(25886805-25886911)
chr7 (137-222)||(4506932-4507017)
chr7 (139-200)||(6782883-6782944)
chr7 (136-257)||(9688868-9688989)
chr7 (137-194)||(40121923-40121980)
chr7 (137-221)||(6991756-6991840)
chr7 (152-236)||(27939160-27939244)
chr7 (143-223)||(32279071-32279151)
chr7 (137-217)||(40898921-40899001)
chr7 (152-215)||(25507445-25507508)
chr7 (137-176)||(33834237-33834276)
chr7 (143-237)||(8075844-8075938)
chr7 (139-252)||(2315271-2315384)
chr7 (148-252)||(9625383-9625487)
chr7 (171-222)||(40792830-40792881)
chr7 (148-251)||(49117224-49117327)
chr7 (150-256)||(33515665-33515771)
chr7 (137-174)||(10882238-10882275)
chr7 (137-217)||(5871955-5872033)
chr7 (163-215)||(21473090-21473142)
chr7 (137-216)||(44874577-44874657)
chr7 (137-176)||(7786253-7786292)
chr7 (155-243)||(32292720-32292805)
chr7 (135-182)||(48420739-48420786)
chr7 (136-251)||(4507733-4507852)
chr7 (137-231)||(18825681-18825775)
chr7 (139-217)||(22339604-22339682)
chr7 (136-194)||(24432150-24432208)
chr7 (157-230)||(1939027-1939099)
chr7 (156-217)||(21213059-21213120)
chr7 (139-191)||(5871576-5871628)
chr7 (167-220)||(10221354-10221409)
chr7 (148-212)||(40991754-40991818)
[»] chr5 (117 HSPs)
chr5 (137-256)||(41666756-41666875)
chr5 (137-255)||(41666992-41667110)
chr5 (138-255)||(9368562-9368679)
chr5 (136-253)||(9368799-9368916)
chr5 (135-256)||(18333462-18333583)
chr5 (137-256)||(24346500-24346619)
chr5 (139-256)||(27132994-27133111)
chr5 (137-256)||(8081112-8081232)
chr5 (149-256)||(95277-95384)
chr5 (137-249)||(15480295-15480407)
chr5 (137-256)||(19705869-19705988)
chr5 (137-256)||(24269870-24269988)
chr5 (137-240)||(24531581-24531684)
chr5 (137-255)||(2063733-2063850)
chr5 (137-256)||(15480523-15480644)
chr5 (140-257)||(24647661-24647778)
chr5 (139-255)||(8098285-8098400)
chr5 (139-255)||(21209922-21210038)
chr5 (137-256)||(13296858-13296977)
chr5 (137-233)||(24528529-24528625)
chr5 (137-256)||(17352434-17352552)
chr5 (137-256)||(20510641-20510760)
chr5 (137-251)||(1564566-1564680)
chr5 (139-253)||(8287771-8287884)
chr5 (137-255)||(24346736-24346854)
chr5 (135-256)||(12034656-12034777)
chr5 (139-256)||(24487646-24487763)
chr5 (137-252)||(18333698-18333814)
chr5 (139-255)||(37782051-37782167)
chr5 (139-255)||(42295546-42295662)
chr5 (153-248)||(6413441-6413536)
chr5 (136-251)||(28510062-28510177)
chr5 (137-255)||(17352667-17352785)
chr5 (132-248)||(21306861-21306977)
chr5 (132-248)||(21314699-21314815)
chr5 (136-256)||(33337236-33337356)
chr5 (148-251)||(7369695-7369798)
chr5 (136-256)||(18885428-18885549)
chr5 (139-257)||(29909722-29909841)
chr5 (149-243)||(15438856-15438950)
chr5 (137-255)||(25258300-25258418)
chr5 (137-255)||(25322090-25322208)
chr5 (137-239)||(38731837-38731939)
chr5 (152-256)||(15590139-15590244)
chr5 (139-256)||(19522287-19522403)
chr5 (143-255)||(6637570-6637680)
chr5 (137-237)||(35167394-35167494)
chr5 (139-242)||(20225021-20225124)
chr5 (137-256)||(38731602-38731721)
chr5 (137-207)||(25258093-25258163)
chr5 (137-207)||(25321883-25321953)
chr5 (142-256)||(29909491-29909605)
chr5 (139-237)||(37656938-37657036)
chr5 (150-251)||(170563-170664)
chr5 (143-256)||(6637803-6637916)
chr5 (149-256)||(17015890-17015994)
chr5 (137-257)||(43117846-43117967)
chr5 (137-217)||(60092-60172)
chr5 (139-255)||(7607561-7607677)
chr5 (137-253)||(13701067-13701183)
chr5 (139-234)||(19522075-19522170)
chr5 (137-255)||(24270105-24270223)
chr5 (163-257)||(8098516-8098610)
chr5 (137-243)||(13296652-13296757)
chr5 (154-248)||(30758315-30758409)
chr5 (179-256)||(4481604-4481681)
chr5 (137-242)||(38976913-38977018)
chr5 (161-249)||(2061961-2062049)
chr5 (139-255)||(6413658-6413773)
chr5 (137-255)||(33337454-33337568)
chr5 (137-256)||(32908717-32908836)
chr5 (137-255)||(6919428-6919544)
chr5 (154-256)||(30770065-30770167)
chr5 (150-251)||(7092121-7092221)
chr5 (156-256)||(3859326-3859426)
chr5 (137-256)||(13700588-13700708)
chr5 (184-256)||(17150279-17150351)
chr5 (171-255)||(30770298-30770382)
chr5 (142-217)||(16707029-16707104)
chr5 (149-256)||(37405055-37405162)
chr5 (137-231)||(2986011-2986105)
chr5 (137-223)||(15438986-15439072)
chr5 (139-253)||(26137110-26137224)
chr5 (138-255)||(26137345-26137463)
chr5 (171-256)||(6919227-6919312)
chr5 (152-228)||(17899474-17899550)
chr5 (135-255)||(29239881-29239998)
chr5 (182-251)||(2985272-2985341)
chr5 (199-256)||(13358367-13358424)
chr5 (136-188)||(9187320-9187372)
chr5 (137-237)||(16571459-16571559)
chr5 (163-255)||(17017116-17017208)
chr5 (173-253)||(31181046-31181126)
chr5 (169-255)||(37656582-37656666)
chr5 (139-193)||(21209709-21209763)
chr5 (156-213)||(12151929-12151986)
chr5 (139-175)||(1028399-1028435)
chr5 (137-253)||(16293320-16293434)
chr5 (200-256)||(24528741-24528797)
chr5 (137-253)||(36040475-36040591)
chr5 (169-240)||(37781709-37781778)
chr5 (139-253)||(11896683-11896800)
chr5 (136-219)||(18140861-18140944)
chr5 (164-230)||(25436193-25436259)
chr5 (149-199)||(31974239-31974289)
chr5 (153-215)||(31974443-31974505)
chr5 (200-256)||(11895977-11896033)
chr5 (72-120)||(40855651-40855699)
chr5 (157-256)||(17584139-17584238)
chr5 (151-251)||(7104239-7104338)
chr5 (137-175)||(43117694-43117732)
chr5 (202-255)||(18885276-18885328)
chr5 (152-217)||(29434081-29434145)
chr5 (139-188)||(34328945-34328994)
chr5 (203-255)||(16704013-16704065)
chr5 (216-256)||(21209765-21209805)
chr5 (216-256)||(26245949-26245989)
[»] chr2 (104 HSPs)
chr2 (137-256)||(16419468-16419587)
chr2 (137-256)||(40379208-40379327)
chr2 (137-255)||(40379443-40379561)
chr2 (135-256)||(5711436-5711557)
chr2 (137-255)||(14466409-14466527)
chr2 (137-255)||(17719367-17719485)
chr2 (137-256)||(5711674-5711793)
chr2 (137-255)||(2029736-2029854)
chr2 (143-256)||(2324206-2324319)
chr2 (151-255)||(32884074-32884178)
chr2 (137-256)||(2029970-2030089)
chr2 (137-256)||(27897605-27897723)
chr2 (142-256)||(2324440-2324554)
chr2 (134-256)||(15124544-15124666)
chr2 (137-255)||(28407792-28407910)
chr2 (138-256)||(29718294-29718412)
chr2 (137-255)||(37840304-37840422)
chr2 (136-256)||(31700743-31700866)
chr2 (139-256)||(40149004-40149121)
chr2 (139-255)||(19191611-19191727)
chr2 (139-253)||(5509048-5509162)
chr2 (139-256)||(17854930-17855047)
chr2 (137-256)||(25082536-25082655)
chr2 (134-256)||(36351921-36352044)
chr2 (137-251)||(14927073-14927187)
chr2 (139-255)||(13486300-13486417)
chr2 (139-256)||(17854693-17854810)
chr2 (139-256)||(33606056-33606172)
chr2 (148-255)||(17525349-17525455)
chr2 (158-256)||(16533513-16533611)
chr2 (143-256)||(5509279-5509392)
chr2 (171-256)||(37812301-37812386)
chr2 (137-255)||(5851680-5851802)
chr2 (139-255)||(12343751-12343867)
chr2 (137-249)||(24395837-24395948)
chr2 (143-255)||(37769948-37770060)
chr2 (154-258)||(37812514-37812618)
chr2 (137-240)||(9927893-9927996)
chr2 (139-256)||(27036416-27036530)
chr2 (137-255)||(42639613-42639731)
chr2 (170-255)||(94052-94137)
chr2 (138-255)||(32356353-32356469)
chr2 (139-256)||(36316052-36316169)
chr2 (143-255)||(40718212-40718324)
chr2 (138-255)||(21591748-21591866)
chr2 (136-256)||(93120-93240)
chr2 (137-213)||(17719575-17719651)
chr2 (137-217)||(19570973-19571053)
chr2 (137-227)||(14927288-14927378)
chr2 (138-256)||(17525099-17525217)
chr2 (134-255)||(8424855-8424976)
chr2 (183-255)||(4662198-4662270)
chr2 (137-229)||(11020551-11020643)
chr2 (156-255)||(15464736-15464835)
chr2 (137-220)||(36352158-36352241)
chr2 (137-255)||(8227316-8227434)
chr2 (137-255)||(35418413-35418531)
chr2 (159-256)||(24396066-24396163)
chr2 (137-218)||(33606288-33606369)
chr2 (136-211)||(15988423-15988499)
chr2 (137-255)||(15124782-15124901)
chr2 (137-224)||(19544370-19544456)
chr2 (137-194)||(16419295-16419352)
chr2 (171-256)||(18607042-18607127)
chr2 (139-223)||(10523018-10523102)
chr2 (139-251)||(10523224-10523336)
chr2 (138-203)||(21383284-21383351)
chr2 (181-256)||(15518726-15518801)
chr2 (173-255)||(3738900-3738982)
chr2 (148-206)||(5450500-5450558)
chr2 (137-207)||(10570985-10571055)
chr2 (135-237)||(24666230-24666331)
chr2 (182-256)||(44403970-44404044)
chr2 (137-214)||(13210534-13210611)
chr2 (136-217)||(30006577-30006658)
chr2 (136-217)||(30063265-30063346)
chr2 (139-212)||(31222531-31222604)
chr2 (170-255)||(40149260-40149343)
chr2 (139-211)||(31008572-31008644)
chr2 (178-242)||(44404198-44404262)
chr2 (139-194)||(27897504-27897559)
chr2 (198-256)||(14466235-14466293)
chr2 (155-211)||(93737-93793)
chr2 (143-255)||(1926446-1926558)
chr2 (196-255)||(25313571-25313631)
chr2 (159-251)||(38629812-38629904)
chr2 (137-176)||(93626-93665)
chr2 (134-189)||(9153815-9153870)
chr2 (137-255)||(19544252-19544367)
chr2 (149-226)||(22126976-22127055)
chr2 (137-191)||(21383669-21383723)
chr2 (170-211)||(93479-93520)
chr2 (135-219)||(4431657-4431743)
chr2 (148-236)||(34515443-34515529)
chr2 (143-187)||(15451454-15451498)
chr2 (137-176)||(93353-93392)
chr2 (204-251)||(11099669-11099716)
chr2 (170-217)||(15988218-15988265)
chr2 (137-216)||(21840323-21840401)
chr2 (139-248)||(789393-789501)
chr2 (148-226)||(13296364-13296442)
chr2 (215-256)||(12343686-12343727)
chr2 (139-176)||(30701126-30701163)
chr2 (149-217)||(15460979-15461047)
[»] chr1 (133 HSPs)
chr1 (137-256)||(35772230-35772349)
chr1 (137-255)||(4113005-4113123)
chr1 (137-242)||(40079132-40079237)
chr1 (137-257)||(2859391-2859511)
chr1 (135-255)||(42586436-42586555)
chr1 (137-255)||(15986332-15986450)
chr1 (137-255)||(52650770-52650888)
chr1 (137-257)||(25713358-25713478)
chr1 (139-255)||(51588959-51589075)
chr1 (137-255)||(17452827-17452945)
chr1 (139-256)||(3169732-3169849)
chr1 (137-257)||(25145719-25145839)
chr1 (137-256)||(25145484-25145603)
chr1 (137-255)||(2859626-2859744)
chr1 (139-248)||(17452680-17452789)
chr1 (139-256)||(51589192-51589309)
chr1 (137-257)||(4112539-4112659)
chr1 (143-255)||(38080572-38080683)
chr1 (136-255)||(20208526-20208643)
chr1 (139-254)||(25137304-25137419)
chr1 (137-256)||(26177109-26177228)
chr1 (137-255)||(26176875-26176993)
chr1 (137-251)||(39348352-39348465)
chr1 (137-255)||(41035826-41035944)
chr1 (136-257)||(39348117-39348238)
chr1 (140-256)||(52961548-52961664)
chr1 (139-233)||(51589795-51589889)
chr1 (137-253)||(16162902-16163018)
chr1 (139-255)||(26173457-26173573)
chr1 (136-256)||(38733348-38733468)
chr1 (136-243)||(31181511-31181618)
chr1 (137-256)||(16163133-16163254)
chr1 (137-255)||(26865357-26865475)
chr1 (137-255)||(30369802-30369920)
chr1 (137-257)||(4098162-4098282)
chr1 (136-256)||(51459703-51459823)
chr1 (137-256)||(855947-856066)
chr1 (137-255)||(35772002-35772114)
chr1 (137-256)||(35892257-35892376)
chr1 (138-256)||(4098403-4098520)
chr1 (137-223)||(8870909-8870995)
chr1 (137-255)||(43409774-43409891)
chr1 (137-222)||(38668125-38668210)
chr1 (143-255)||(11924888-11925000)
chr1 (151-255)||(12244975-12245079)
chr1 (152-256)||(38668326-38668430)
chr1 (137-217)||(49142958-49143038)
chr1 (139-255)||(52127688-52127803)
chr1 (137-256)||(7653442-7653561)
chr1 (136-251)||(21626337-21626452)
chr1 (137-256)||(27413313-27413432)
chr1 (137-256)||(27413548-27413667)
chr1 (137-255)||(25255279-25255396)
chr1 (152-256)||(3169966-3170071)
chr1 (489-576)||(27254330-27254417)
chr1 (137-243)||(3477175-3477281)
chr1 (142-255)||(28408043-28408159)
chr1 (148-254)||(39808434-39808539)
chr1 (174-256)||(51459866-51459948)
chr1 (139-256)||(51590006-51590121)
chr1 (135-223)||(26173227-26173309)
chr1 (137-245)||(32223740-32223848)
chr1 (181-256)||(8870732-8870807)
chr1 (137-203)||(31432229-31432295)
chr1 (137-223)||(49142507-49142593)
chr1 (139-217)||(52907389-52907467)
chr1 (173-256)||(4112805-4112889)
chr1 (139-239)||(9499229-9499328)
chr1 (148-251)||(17468315-17468419)
chr1 (135-255)||(32952038-32952158)
chr1 (137-256)||(7307687-7307806)
chr1 (461-576)||(27294425-27294540)
chr1 (136-215)||(29898919-29898998)
chr1 (137-255)||(17402549-17402667)
chr1 (137-207)||(29265968-29266038)
chr1 (137-203)||(33156752-33156818)
chr1 (139-217)||(40316051-40316129)
chr1 (135-217)||(42351857-42351939)
chr1 (148-217)||(31004447-31004516)
chr1 (138-251)||(34264710-34264823)
chr1 (148-232)||(11234206-11234290)
chr1 (155-255)||(26603395-26603495)
chr1 (170-256)||(17412533-17412619)
chr1 (137-223)||(26346968-26347053)
chr1 (137-255)||(38733119-38733236)
chr1 (187-256)||(51460130-51460200)
chr1 (181-254)||(369603-369676)
chr1 (178-251)||(7826071-7826144)
chr1 (186-254)||(17412304-17412372)
chr1 (137-213)||(33157230-33157306)
chr1 (154-249)||(9146570-9146665)
chr1 (149-228)||(17402708-17402787)
chr1 (137-212)||(22377542-22377617)
chr1 (205-256)||(33156935-33156986)
chr1 (137-215)||(11525004-11525082)
chr1 (136-214)||(40188983-40189061)
chr1 (137-217)||(41066944-41067024)
chr1 (137-213)||(50695833-50695909)
chr1 (139-215)||(51460443-51460519)
chr1 (159-242)||(12488987-12489070)
chr1 (188-255)||(13386215-13386282)
chr1 (158-251)||(9830546-9830644)
chr1 (137-255)||(32783280-32783397)
chr1 (205-255)||(33156405-33156455)
chr1 (174-256)||(51460243-51460325)
chr1 (137-218)||(5109488-5109569)
chr1 (178-215)||(7465685-7465722)
chr1 (204-257)||(7652283-7652336)
chr1 (137-214)||(9146863-9146940)
chr1 (138-215)||(11525219-11525296)
chr1 (185-242)||(40524698-40524755)
chr1 (143-211)||(5953201-5953269)
chr1 (138-194)||(12376673-12376729)
chr1 (139-191)||(38739656-38739708)
chr1 (137-212)||(39544406-39544479)
chr1 (142-217)||(16173210-16173283)
chr1 (136-171)||(20208227-20208262)
chr1 (159-201)||(5953497-5953539)
chr1 (137-223)||(7653241-7653326)
chr1 (150-200)||(17557720-17557770)
chr1 (137-223)||(21427102-21427188)
chr1 (137-171)||(51460049-51460083)
chr1 (139-217)||(52215127-52215205)
chr1 (137-194)||(8749966-8750023)
chr1 (157-194)||(12509511-12509548)
chr1 (202-255)||(35303504-35303557)
chr1 (137-186)||(49868644-49868693)
chr1 (137-177)||(2120122-2120162)
chr1 (179-255)||(4000245-4000320)
chr1 (199-251)||(22100053-22100105)
chr1 (149-217)||(26229573-26229641)
chr1 (203-239)||(42819283-42819319)
chr1 (140-192)||(49142746-49142798)
[»] scaffold0766 (1 HSPs)
scaffold0766 (141-256)||(6240-6355)
[»] scaffold0692 (2 HSPs)
scaffold0692 (137-254)||(5753-5870)
scaffold0692 (137-222)||(5543-5628)
[»] scaffold0129 (2 HSPs)
scaffold0129 (137-243)||(14282-14388)
scaffold0129 (200-254)||(14506-14560)
[»] scaffold0092 (2 HSPs)
scaffold0092 (137-255)||(5622-5740)
scaffold0092 (135-256)||(5856-5977)
[»] scaffold0334 (1 HSPs)
scaffold0334 (140-257)||(4431-4548)
[»] scaffold0400 (1 HSPs)
scaffold0400 (139-253)||(3813-3928)
[»] scaffold0365 (1 HSPs)
scaffold0365 (139-253)||(4457-4572)
[»] scaffold0005 (2 HSPs)
scaffold0005 (139-255)||(56426-56542)
scaffold0005 (137-251)||(288656-288770)
[»] scaffold0048 (2 HSPs)
scaffold0048 (137-255)||(81809-81927)
scaffold0048 (137-256)||(82042-82161)
[»] scaffold0481 (2 HSPs)
scaffold0481 (139-256)||(3472-3589)
scaffold0481 (139-256)||(3241-3355)
[»] scaffold0047 (2 HSPs)
scaffold0047 (137-254)||(12615-12732)
scaffold0047 (159-256)||(12847-12944)
[»] scaffold0181 (1 HSPs)
scaffold0181 (137-255)||(20906-21024)
[»] scaffold0027 (1 HSPs)
scaffold0027 (136-256)||(121519-121640)
[»] scaffold0050 (1 HSPs)
scaffold0050 (162-254)||(69557-69649)
[»] scaffold0417 (1 HSPs)
scaffold0417 (459-580)||(12705-12826)
[»] scaffold0083 (1 HSPs)
scaffold0083 (137-222)||(51236-51321)
[»] scaffold0060 (1 HSPs)
scaffold0060 (154-255)||(20542-20643)
[»] scaffold0001 (1 HSPs)
scaffold0001 (197-254)||(429841-429898)
[»] scaffold0041 (2 HSPs)
scaffold0041 (137-217)||(67490-67570)
scaffold0041 (137-217)||(67283-67363)
[»] scaffold0459 (2 HSPs)
scaffold0459 (182-256)||(13299-13373)
scaffold0459 (178-242)||(13081-13145)
[»] scaffold0366 (4 HSPs)
scaffold0366 (182-256)||(10940-11014)
scaffold0366 (182-256)||(14606-14680)
scaffold0366 (178-242)||(10722-10786)
scaffold0366 (181-242)||(14388-14449)
[»] scaffold0024 (1 HSPs)
scaffold0024 (137-256)||(89552-89671)
[»] scaffold0003 (1 HSPs)
scaffold0003 (137-215)||(347570-347648)
[»] scaffold0729 (2 HSPs)
scaffold0729 (158-255)||(2476-2575)
scaffold0729 (206-256)||(2695-2745)
[»] scaffold0045 (1 HSPs)
scaffold0045 (137-217)||(41205-41284)
[»] scaffold1034 (1 HSPs)
scaffold1034 (196-255)||(3203-3262)
[»] scaffold0211 (1 HSPs)
scaffold0211 (137-190)||(24633-24686)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 6e-91; HSPs: 126)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 288 - 580
Target Start/End: Complemental strand, 6792647 - 6792357
Alignment:
288 aatcggagcataactcccgatcgacttatttaagaggttgagcaatgtgagaggcctatagagcagagcattcaccactaataagtagaaattcgcatta 387  Q
    |||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| || |     ||||| ||||||||||||||||| ||||||    
6792647 aatcggagcataactcccaatcggcttattaaagaggttgagcaatgtgagaggcctatatagaa-----ttcactactaataagtagaaattagcatta 6792553  T
388 atcttaaaagaaaatgttacaaatgttatgtgatggagtagttaacaaaagaaaaatagaaatacaattatttgaaggaatttgtgt---agcaaggagc 484  Q
    |||| |||| | | | |||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||   ||||||||      
6792552 atctcaaaacagatttttacaaatgttatgtgatggagtagttaacaaaagaaaaacagaattaaaattatttgaaggaatttgtgtacaagcaaggaat 6792453  T
485 tgtacttttagaagataaatgaggttttaatcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtctatccaaaacagaagtcattac 580  Q
    ||||||| ||||||| ||||||||||| |||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||    
6792452 tgtacttatagaagacaaatgaggtttaaatcttgcttcaccaataaaacctaaaccataagcacgtgcaggtctatccaaaacagaagtcattac 6792357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 35038191 - 35038312
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||    
35038191 attcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcaccta 35038290  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
35038291 tccgatgtgggactcttaacac 35038312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 16239676 - 16239557
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
16239676 tcttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggtttgcccccacttataaacacattgtcaggccatgtcctatc 16239577  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
16239576 cgatgtgagactcttaacac 16239557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 11589868 - 11589752
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
11589868 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 11589769  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
11589768 atgtgagactcttaaca 11589752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 35038427 - 35038545
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | ||||||||||||||||||||||||||||| | |||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||    
35038427 tcttagaagtcgtggttgggcctaacacaaccccacaaaaccagcttgtcaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 35038526  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
35038527 cgatgtgggactcttaaca 35038545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 54567977 - 54567859
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||    
54567977 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatgtcctatc 54567878  T
237 cgatgtgtgactcttaaca 255  Q
    |||| |  |||||||||||    
54567877 cgatataggactcttaaca 54567859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 143 - 256
Target Start/End: Original strand, 20327619 - 20327732
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||    
20327619 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgt 20327718  T
243 gtgactcttaacac 256  Q
    | || |||||||||    
20327719 gggattcttaacac 20327732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 9273044 - 9272928
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||  ||||| |||    
9273044 ttagaaatggtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaacaaattatcaggccaattcctaaccg 9272945  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
9272944 atgtgagactcttaaca 9272928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 20327850 - 20327966
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
20327850 ttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 20327949  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
20327950 atgtgggactcttaaca 20327966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 54368601 - 54368482
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||    
54368601 tcttagaaatcgtggttgggtctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatcttctatc 54368502  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
54368501 ggatgtgggactcttaacac 54368482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 1723075 - 1723192
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| || ||| |    
1723075 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaact-ctaac 1723173  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
1723174 cgatgtgggactcttaaca 1723192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 22729185 - 22729067
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||| ||||||| |||||||||| |||||| |||||||||||| ||||||||||||||| ||||||||||||    
22729185 tcttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatc 22729086  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||| ||||    
22729085 cgatgtgggactctgaaca 22729067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 8019053 - 8018934
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||| ||| |||||||| || ||| |    
8019053 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaacaaattttcaggccaacttctaac 8018954  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
8018953 cgatgtgggactcttaacac 8018934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 39620411 - 39620292
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||| ||||||||||||||||||  ||||| ||||||| ||||| |||||||||||||||||||||||||| |||| ||||||    
39620411 tcttagaaatcgtggttgggcttaacacaaccccacaaaactggcttatgaggtgcgggttacccccacttataaacacattgtcaggtcatcacctatc 39620312  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
39620311 cgatgtgagactcttaacac 39620292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 4155409 - 4155291
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||  |||| |||||| || ||||    
4155409 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaacacgctgtctggccatgtcatatc 4155310  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
4155309 cgatgtgggactcttaaca 4155291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 16926948 - 16927066
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| || |||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||| | |||||    
16926948 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccggcttgtgagatgaggattacccccacttataaacacattgtcaggccatgttctatc 16927047  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
16927048 cgatgtgggactcttaaca 16927066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 146 - 255
Target Start/End: Original strand, 38791458 - 38791567
Alignment:
146 tggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtg 245  Q
    ||||||||||||||||||||||||||||||||||  ||||||||||||| ||| || |||||||||| |||||||||| ||||||||||||||||||| |    
38791458 tggtggttgggcctaacacaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctcctatccgatgtggg 38791557  T
246 actcttaaca 255  Q
    ||||||||||    
38791558 actcttaaca 38791567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 4155645 - 4155525
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||||||||||||||| | |||| |||||| |||||||||| ||| ||||||||||||||||||||||||||| | ||||||    
4155645 ttcttagaaatcgtggttgggcctaacacaaccctaaaaaaccggcttttgaggtgaggattgtccccacttataaacacattgtcaggccttgtcctat 4155546  T
236 ccgatgtgtgactcttaacac 256  Q
     ||||||| ||||||||||||    
4155545 gcgatgtgggactcttaacac 4155525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 16239913 - 16239793
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||| |||| |||||||||||||||||||| || |||||||||||||  ||||||||||||||||||| ||||||||||||| ||||||    
16239913 ttcttagaaattgtgcttggacctaacacaaccccacaaaaccgacttgtgaggtgagatttgcccccacttataaacatattgtcaggccatgtcctat 16239814  T
236 ccgatgtgtgactcttaacac 256  Q
    |||  ||||||||||||||||    
16239813 ccgtcgtgtgactcttaacac 16239793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 31317552 - 31317432
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | ||  ||||||||||||||||||||||| | ||| ||||||    
31317552 ttcttagaaatcgtggttgggcctaacacaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaacacattgtcatgtcatgtcctat 31317453  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||  ||||||||||||    
31317452 ccgatgtaggactcttaacac 31317432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 12930127 - 12930245
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||  ||| |||||| ||| |||||||||||||| |||||| ||||    
12930127 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgagaattgtccccacatatgaacacattgtcaggtcatctcttatc 12930226  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||| ||||||    
12930227 cgatgtgagacttttaaca 12930245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 20303063 - 20303182
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||| ||||||||||| ||||||||| ||| ||||||||||||| ||||||||||||||||| ||||||||||||||| || ||||    
20303063 tcttaaaaatcgtggttgagcctaacacaatcccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatc 20303162  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| || |||||||||    
20303163 cgatgtgggattcttaacac 20303182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 248
Target Start/End: Original strand, 45138970 - 45139081
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| || |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| ||||||||||||||| ||||    
45138970 tcttagaaatcgtggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggccatctcttatc 45139069  T
237 cgatgtgtgact 248  Q
     |||||| ||||    
45139070 agatgtgggact 45139081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 7697397 - 7697514
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||| | ||||||||||||| | |||||||||||||| |||| |||||| || |||||||||||    
7697397 tcttagaaattgtggttaggcctaacacaaccccacaaaaccagcttgtgaggtgatgattgcccccacttat-aacatattgtctggtcatctcctatc 7697495  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
7697496 cgatgtgggactcttaaca 7697514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 17638319 - 17638202
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||| ||||| | ||||||||||||||| ||| ||||||||||||||| |||||||||||| |||||| |    
17638319 tcttagaaatcgtggttgggcctaacacaacccctcaaaaccagcttgtgaggtgaggattg-ccccacttataaacaaattgtcaggccaactcctaac 17638221  T
237 cgatgtgtgactcttaaca 255  Q
    |||||||  ||||||||||    
17638220 cgatgtggaactcttaaca 17638202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 137 - 234
Target Start/End: Original strand, 472059 - 472156
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||| ||||| |||||| |||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||    
472059 tctttgaaatcgtggtttggcctaacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaagccatctccta 472156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 9273274 - 9273161
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||||||||| ||||||||||||||||||||| | |||||||| |||||| ||||||||||||||||||| |||||||| |||  ||||| |||||||    
9273274 aaatggtggttgagcctaacacaaccccacaaaaccagcttgtgaagtgaggattgcccccacttataaacaaattgtcagaccaattcctaaccgatgt 9273175  T
243 gtgactcttaacac 256  Q
    | ||||||||||||    
9273174 gggactcttaacac 9273161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 3975357 - 3975477
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||||||  |||||||||||||||| ||||||| | ||  |||||||||||||||||||||||||  ||| ||||||    
3975357 tcttagaaatagtggttgggtctaacacaattccacaaaatcggcttgagaggtgatgattatccccacttataaacacattgtcaggttatcacctatc 3975456  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||| |||||||||||||||    
3975457 cgatgcgtgactcttaacacc 3975477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 6487338 - 6487450
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| |||||||||||||| ||||||||| |||| ||||||||||||||||| || || ||||||||||||| |||||||||||| |||||| |||||||    
6487338 aaatcgtggttgggcctaaaacaaccccataaaaccggcttgtgaggtgaggattacctccacttataaacaaattgtcaggccaactcctaaccgatgt 6487437  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
6487438 gggactcttaaca 6487450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 17001422 - 17001538
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||||| |||||||| |||||||||||||| ||| |||||||| | |||||||||||||||||||||||||||| | | ||||||||||    
17001422 ttagaaatcatggttggacctaacactaccccacaaaatcgccttatgaggtgatgattgcccccacttataaacacattgtcagacgaactcctatccg 17001521  T
239 atgtgtgactcttaaca 255  Q
    || ||||||||||||||    
17001522 atatgtgactcttaaca 17001538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 18757927 - 18757807
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||| ||||| ||||||||||||||||||||||||||||| || ||||||| |||||| | |||||||||||||||||||| |||||| || ||||||||    
18757927 tcttggaaatcgtggttgggcctaacacaaccccacaaaaccgccttgtgatgtgaggatcgcccccacttataaacacatagtcaggtcaactcctatc 18757828  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| ||||  |||||||    
18757827 cgatgtgggacttgtaacacc 18757807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 144 - 255
Target Start/End: Original strand, 27670398 - 27670509
Alignment:
144 aatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||||||||||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||||  |||||||||||  ||||  ||||||||    
27670398 aatggtggttgggcctaacacaaccccacaaaaccggcctttgaggtgaggattgcccccacttataaacaatttgtcaggccaattcctgaccgatgtg 27670497  T
244 tgactcttaaca 255  Q
     |||||||||||    
27670498 ggactcttaaca 27670509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 243
Target Start/End: Original strand, 50083079 - 50083186
Alignment:
137 tcttagaaatggtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||  |||||||||||||||||||||| |||||| ||||||||||||||||| || ||||||||||||||||||||||| ||||||| | |||    
50083079 tcttagaaatcatggttgggcctaacacaacccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcgggccatcacttat 50083178  T
236 ccgatgtg 243  Q
    ||||||||    
50083179 ccgatgtg 50083186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 31317313 - 31317196
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| ||||||||||| ||||||||| ||||||||||||||||| ||| |||||||||||||||||||| || || || || ||||    
31317313 tcttagaaatcgtggttgagcctaacacaatcccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacacattgccatgctatgtcttatc 31317215  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
31317214 cgatgtgggactcttaaca 31317196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 141 - 243
Target Start/End: Original strand, 45138805 - 45138907
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| ||||||||| || | |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||| ||||||||    
45138805 agaaatcgtggttgggtctcatacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttatccgat 45138904  T
241 gtg 243  Q
    |||    
45138905 gtg 45138907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 293 - 475
Target Start/End: Complemental strand, 6786569 - 6786389
Alignment:
293 gagcataactcccgatcgacttatttaagaggttgagcaatgtgagaggcctatagagcagagcattcaccactaataagtagaaattcgcattaatctt 392  Q
    |||| ||||||||||||| ||||||| ||||| |||||||| |||| || |||||||||| |    |||||| ||||||||||||| |  ||||||| ||    
6786569 gagcgtaactcccgatcggcttattttagaggctgagcaatctgaggggactatagagcaaaa---tcaccattaataagtagaaagtaacattaatttt 6786473  T
393 aaaagaaaatgttacaaatgttatg-tgatggagtagttaacaaaagaaaaatagaaatacaattatttgaaggaatttgtgta 475  Q
    |||| ||||| |||||||| ||||| ||  |||||||||||||||||||||| ||| ||| ||||||||||| ||| |||||||    
6786472 aaaacaaaattttacaaatattatgatggaggagtagttaacaaaagaaaaacagatataaaattatttgaaagaacttgtgta 6786389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 39269416 - 39269296
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| || ||| |||||||||||| ||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| | || ||    
39269416 tcttaaaaatcgtagttaggcctaacacaatccctcaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctc 39269317  T
237 cgatgtgtgactcttaacacc 257  Q
    | ||||| |||||||||||||    
39269316 caatgtgggactcttaacacc 39269296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 34610646 - 34610527
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| ||||||||| ||||||||||||||||||| || |||||||||||||| ||| |||||||||||||||| |||||||||||| ||| | |    
34610646 tcttagaaattgtggttgggtctaacacaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcaggccaactcatgt 34610547  T
236 ccgatgtgtgactcttaaca 255  Q
    | ||| || |||||||||||    
34610546 ctgatatgggactcttaaca 34610527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 162 - 256
Target Start/End: Original strand, 23691216 - 23691310
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||| |||||||| ||||||||||||    
23691216 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23691310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 162 - 256
Target Start/End: Original strand, 23708016 - 23708110
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||| |||||||| ||||||||||||    
23708016 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23708110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 162 - 256
Target Start/End: Original strand, 23726472 - 23726566
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||| |||||||| ||||||||||||    
23726472 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23726566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 162 - 256
Target Start/End: Original strand, 23744928 - 23745022
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||| |||||||| ||||||||||||    
23744928 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 23745022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 162 - 256
Target Start/End: Original strand, 24063453 - 24063547
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| | |||||| |||||||| ||||||||||||    
24063453 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaacac 24063547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 39683268 - 39683386
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccac-ttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||| ||||||| |||||| |||| ||||||||| || |||||||||||||| ||||| |||| ||||||||||||||||||| ||||  ||||||    
39683268 ttagaaatcgtggttgagcctaatacaatcccacaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcaggtcatcatctatcc 39683367  T
238 gatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||    
39683368 gatgtgggactcttaacac 39683386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 138 - 251
Target Start/End: Complemental strand, 45828330 - 45828217
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||||  |||||||||||||||||||||||||||| | ||||||||||||  | ||||||||||||||||||||||  |||||||||||  | |||    
45828330 cttagaaatcatggttgggcctaacacaaccccacaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtcc 45828231  T
238 gatgtgtgactctt 251  Q
    |||||| |||||||    
45828230 gatgtgggactctt 45828217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 4008770 - 4008651
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||||||||||||| | ||||||||||||||  ||||||| | |  |||||| ||||||||| |||||||||||||| ||||||    
4008770 tcttaaaaatagtggttgggcctaacacaatctcacaaaatcggcttaagaggtgatgatcacccccatttataaacatattgtcaggccatcacctatc 4008671  T
237 cgatgtgtgactcttaacac 256  Q
    ||||| | ||||||||||||    
4008670 cgatgcgagactcttaacac 4008651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 23708223 - 23708342
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||| |||| |||||||||| | ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| | | |||||| |    
23708223 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23708322  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
23708323 tgatgtgggactcttaacac 23708342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 23726679 - 23726798
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||| |||| |||||||||| | ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| | | |||||| |    
23726679 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23726778  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
23726779 tgatgtgggactcttaacac 23726798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 23745135 - 23745254
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||| |||| |||||||||| | ||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| | | |||||| |    
23745135 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaac 23745234  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
23745235 tgatgtgggactcttaacac 23745254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 139 - 217
Target Start/End: Original strand, 13574922 - 13575000
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| |||||||||||||||||||||||||||||  |||||||||||||||| || |||||||||||||||||||    
13574922 ttagaaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaacacat 13575000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 139 - 228
Target Start/End: Original strand, 50052540 - 50052630
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccat 228  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||| |||||| ||| ||||||||||||||||||| ||| ||||||    
50052540 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaacacatggtcgggccat 50052630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 49629684 - 49629572
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||||  ||||| ||||||||||||||||||| ||| |||||||||| || ||||| ||||||||||||||||| ||| |||||||||||||| ||||    
49629684 aaatggtaattgggtctaacacaaccccacaaaaccggtttgtgaggtggggattgccgccacttataaacacattttca-gccatctcctatccaatgt 49629586  T
243 gtgactcttaacac 256  Q
    |  |||||||||||    
49629585 ggaactcttaacac 49629572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 236
Target Start/End: Complemental strand, 43781668 - 43781569
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||| | |||||| || ||||||| |||||| ||||| |||||||||||| |||||||||| ||||| |||||    
43781668 tcttagaaattgtggttgggcctaacacaactctacaaaaccgacttgtgaagtgaggattgcctccacttataaactcattgtcaggtcatcttctatc 43781569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 17638492 - 17638374
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||| |||| ||| |||||||||||||||||  | |||| ||||||||||| ||||| ||||||| ||||||||||| |||||||||||| || |||    
17638492 attcttaaaaatcgtgattgggcctaacacaacc--ataaaaccggcttgtgagatgaggattgcccc-acttataaacaaattgtcaggccagcttcta 17638396  T
235 tccgatgtgtgactcttaacac 256  Q
     |||||||| ||||||||||||    
17638395 accgatgtgggactcttaacac 17638374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 30179707 - 30179821
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| |||||||||| ||||| || || ||||||  | |||||||||||||| || |||||||||||||||||||||||||| |||||| ||||    
30179707 tcttataaatcgtggttgggcataacataatcctacaaaactgacttgtgaggtgaggattacccccacttataaacacattgtcaggtcatctcttatc 30179806  T
237 cgatgtgtgactctt 251  Q
     |||||| |||||||    
30179807 tgatgtgggactctt 30179821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 143 - 235
Target Start/End: Original strand, 13741106 - 13741199
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg-gttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||| ||||||||| |||||||||||||| |||| |||||||||||||||||  ||| |||||||||||||||||||||||  |||||||||||    
13741106 aaattgtggttgggtctaacacaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtcaaaccatctcctat 13741199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 28087214 - 28087336
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggtt----gcccccacttataaacacattgtcaggccatctcc 232  Q
    |||||||||| ||| ||||| || |||||| ||||||||| ||||||||||||||| | ||    ||||||||||||||||| ||||| |||||| ||||    
28087214 tcttagaaatcgtgattgggtctgacacaatcccacaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggccaactcc 28087313  T
233 tatccgatgtgtgactcttaaca 255  Q
    || |||||||| |||||||||||    
28087314 taaccgatgtgagactcttaaca 28087336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 45828104 - 45828027
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||| ||||| ||||||||||||||| ||||||| ||||||||||||||||| ||||||| |||||||||||    
45828104 tcttagaaattgtggtagggcctaacacaacctcacaaaaccggcttgtgaggtgaggattgccccaacttataaaca 45828027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 148 - 236
Target Start/End: Complemental strand, 1800289 - 1800201
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||| || |||||||||||||||| ||| ||||||||||||| ||||||||||||||||| ||| |||||| ||||||| ||||    
1800289 gtggttgggtcttacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcagaccatctcttatc 1800201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 6786738 - 6786667
Alignment:
1 gaaaaacagatgattaatgttaaaatatgacaaataaccatgtgacagaggaaaggtgattaacaagagtaa 72  Q
    ||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||| ||| ||||    
6786738 gaaaaacagatgatttatgttaaaatatgacaaataatcatgtgacggaggaaaggtgattaataagggtaa 6786667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 140 - 251
Target Start/End: Original strand, 13574686 - 13574797
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | | |||| ||||||||||| |||  ||| ||||| |  | |||||    
13574686 tagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgatcgcccgcacttataaacgcatgctcaagccatattttgtccga 13574785  T
240 tgtgtgactctt 251  Q
    |||| |||||||    
13574786 tgtgggactctt 13574797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 137 - 200
Target Start/End: Complemental strand, 24866282 - 24866219
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcc 200  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||    
24866282 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcc 24866219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 135 - 230
Target Start/End: Complemental strand, 33205552 - 33205457
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    |||| ||||||| ||||||||||||||||||||||| |||||  |||||||||||||||| ||||||  || |||||||||||  |||||||||||    
33205552 attcatagaaatcgtggttgggcctaacacaaccccgcaaaactggcttgtgaggtgaggattgcccttacatataaacacatgttcaggccatct 33205457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 24063660 - 24063746
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| ||| |||| |||||||||| | ||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||    
24063660 tcttaaaaattgtgattggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 24063746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 180 - 253
Target Start/End: Complemental strand, 54368764 - 54368691
Alignment:
180 gcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |||||||||||  |||||||||    
54368764 gcttgtgaggtgaggattgccaccacttataaatacattgtcaggccatcttctatccgatgttggactcttaa 54368691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 135 - 251
Target Start/End: Original strand, 2806283 - 2806399
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||| | |||||||||| ||||||||||||  |||||||||||||||| || | |||||||||||||||||   | ||||||||  ||    
2806283 attcttagaaattgtgttggggcctaacaaaaccccacaaaactggcttgtgaggtgaggattccacccacttataaacacatgtaccggccatctttta 2806382  T
235 tccgatgtgtgactctt 251  Q
    |||||| || |||||||    
2806383 tccgatatgagactctt 2806399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 509 - 573
Target Start/End: Complemental strand, 6799639 - 6799575
Alignment:
509 ttttaatcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtctatccaaaacagaag 573  Q
    |||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| |||||    
6799639 ttttaatcttgcttcaccaataaaacctaaaccataagaaggtgcaggtctatccaaaaaagaag 6799575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 137 - 253
Target Start/End: Original strand, 21809146 - 21809262
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| ||| || |||||||| || |||||| |||||||||||||| || ||||||||||||||||  | |||||||| |||||  |||||    
21809146 tcttagaaatcgtgtttgagcttaacacaatcctacaaaaccggcttgtgaggtgtggattgcccccacttataattatattgtcagaccatcagctatc 21809245  T
237 cgatgtgtgactcttaa 253  Q
    |||||||  ||||||||    
21809246 cgatgtggcactcttaa 21809262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 27086675 - 27086554
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt---ataaacacattgtcaggccatctcct 233  Q
    ||||||||||  ||||||||||||||||||| |||||||| |  ||||| || ||||| |||  | |||||   |||||||||||||||||||||| |||    
27086675 tcttagaaatcatggttgggcctaacacaactccacaaaaccaacttgtaagatgaggattgtactcacttataataaacacattgtcaggccatcacct 27086576  T
234 atccgatgtgtgactcttaaca 255  Q
    ||| |||||| |||||||||||    
27086575 atctgatgtgggactcttaaca 27086554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 140 - 251
Target Start/End: Complemental strand, 33640362 - 33640253
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| ||||||| || ||||||||||| ||||| | || ||||||||||| | ||| |||||||||||||||||||||||| || |||| |||||||    
33640362 tagaaattgtggttgagcttaacacaaccc-acaaatttggtttgtgaggtgaagattgtccccacttataaacacattgtcagacc-tctcttatccga 33640265  T
240 tgtgtgactctt 251  Q
     |||||||||||    
33640264 cgtgtgactctt 33640253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 196 - 255
Target Start/End: Complemental strand, 34992576 - 34992517
Alignment:
196 ttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||    
34992576 ttgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca 34992517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 154 - 255
Target Start/End: Original strand, 23610387 - 23610488
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt-caggccatctcctatccgatgtgtgactctta 252  Q
    ||||||||||||||||||||||| |||| |||||| ||||| || ||||||||||||||||| |||| ||| ||||||| ||||| ||| | ||||||||    
23610387 gggcctaacacaaccccacaaaaccggcctgtgagttgaggattacccccacttataaacac-ttgtccagaccatctcttatccaatgggagactctta 23610485  T
253 aca 255  Q
    |||    
23610486 aca 23610488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 23691423 - 23691509
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| ||| |||| |||||||||| | ||||||  ||||||||||||||||| ||||||||||||||||||| ||||||||    
23691423 tcttaaaaattgtgattggacctaacacaatctcacaaatccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 23691509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 30138108 - 30138046
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| |||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||    
30138108 cggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30138046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 30147659 - 30147597
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| |||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||    
30147659 cggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30147597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 148 - 229
Target Start/End: Complemental strand, 20479082 - 20479001
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    ||||||||||||| ||| ||| ||||||| ||||||||||||||||| || |||||||||||||||| ||  ||||||||||    
20479082 gtggttgggcctatcaccacctcacaaaaacggcttgtgaggtgaggatttcccccacttataaacatatgttcaggccatc 20479001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 137 - 192
Target Start/End: Original strand, 26272323 - 26272378
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||    
26272323 tcttagaaattgtggttgggtctaacacaaccccacaaaatcagcttgtgaggtga 26272378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 161 - 255
Target Start/End: Complemental strand, 2123868 - 2123774
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||| | ||||| | |||| ||||||||| |||||| |||||||||||||||| ||||  ||| |||||||||| ||| |||||||||||    
2123868 acacaaccctataaaattgacttgcgaggtgaggattgccctcacttataaacacattatcagatcatgtcctatccgacgtgagactcttaaca 2123774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 41915255 - 41915142
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | ||||||||||||||||||| || | ||||  || ||||||||||||| ||||||||||||||||||||||  ||| | |||||| | ||    
41915255 tcttagaatttgtggttgggcctaacacaaacc-ataaaactggtttgtgaggtgaggattgcccccacttataaacacatgttcatgtcatctcttttc 41915157  T
237 cgatgtgtgactctt 251  Q
    | ||||| |||||||    
41915156 caatgtgggactctt 41915142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 50930763 - 50930681
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    |||||||||||||||| ||  ||||||||||||| ||||||||||||||||||||||  | |||||||||  |||| ||||||    
50930763 acacaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacatgttaaggccatcttttatcagatgtg 50930681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 157 - 248
Target Start/End: Complemental strand, 2805428 - 2805336
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||||| ||||||||| |  ||| |||||||||  |||||||| ||||||||||||||||| || ||||||| |||||||||| |||||    
2805428 cctaacacaatcccacaaaaccaacttatgaggtgagaattgccccccacttataaacacattgttagaccatctcatatccgatgtatgact 2805336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 253
Target Start/End: Original strand, 29575889 - 29576005
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||  ||||||||||| ||  ||| || ||||||| ||||   ||| || |||||||||||||||| ||||| |||||| ||||    
29575889 tcttaaaaattgtggttggatctaacacaacctcagcaaaccgacttgtgatgtgataattgtcctcacttataaacacattctcaggtcatctcttatc 29575988  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
29575989 cgatgtgagactcttaa 29576005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 50052773 - 50052879
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgc-ccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||| |||||||||||||||||||       ||| |||||||||||| |||| |||| |||||||||||||||||| |||||||||| |  | |||    
50052773 ttagaaatagtggttgggcctaacacaa-------aaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggccatattttgtcc 50052865  T
238 gatgtgtgactctt 251  Q
    |||||| |||||||    
50052866 gatgtgggactctt 50052879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 150 - 204
Target Start/End: Complemental strand, 14611248 - 14611194
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccca 204  Q
    |||||||||||||||||| |||| ||| ||||||||||||||||| |||||||||    
14611248 ggttgggcctaacacaactccactaaaccggcttgtgaggtgaggattgccccca 14611194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 14839736 - 14839854
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||  ||||||| | |||||||||||  |||||| || ||||| | |||||| ||||||| ||||||||| ||||| |||| |||||  |||||    
14839736 tcttagaaaatgtggttgagtctaacacaaccatacaaaaccgacttgtaacgtgaggattgccccaacttataaatacattatcagaccatcaactatc 14839835  T
237 cgatgtgtgactcttaaca 255  Q
     ||||||  ||||||||||    
14839836 tgatgtgaaactcttaaca 14839854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 20264390 - 20264289
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||||||| |||| ||||||||||  |||| ||||||||||||||||| |||||| ||||| |||  ||| ||||||||  |||| ||||| ||||    
20264390 tggttgggcctatcacagccccacaaaactggct-gtgaggtgagggttgccaccacttttaaactcatgttcaagccatctcacatccaatgtgggact 20264292  T
249 ctt 251  Q
    |||    
20264291 ctt 20264289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 33640130 - 33640076
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    |||||||||| ||| ||||||||||||||| ||||||||| ||||||||||||||    
33640130 tcttagaaattgtgattgggcctaacacaatcccacaaaaccggcttgtgaggtg 33640076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 173 - 255
Target Start/End: Complemental strand, 35018760 - 35018678
Alignment:
173 aaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||| |||||||  ||||||||||||||||||| ||  ||| ||||||||| |||| ||||| || ||||||||    
35018760 aaaatcggcttgtaaggtgagcattgcccccacttataaacatatgttcaagccatctcccatccaatgtgggattcttaaca 35018678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 222
Target Start/End: Original strand, 8142407 - 8142491
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    |||||||||| ||| ||||||||| ||||||| ||||||| ||||||||||||||||| ||||| | | ||||||| | |||||||    
8142407 tcttagaaatcgtgattgggccta-cacaacctcacaaaaccggcttgtgaggtgaggattgcctctatttataaatatattgtca 8142491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 20303386 - 20303435
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgag 188  Q
    |||||||| |||||||| |||||||||||||||||||| |||||||||||    
20303386 ttagaaattgtggttggacctaacacaaccccacaaaaccggcttgtgag 20303435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 47702410 - 47702471
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcc 200  Q
    |||||||| ||||||||||||||||||||||||||||| | |||||| || ||||| |||||    
47702410 ttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaagatgaggattgcc 47702471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 149 - 249
Target Start/End: Original strand, 22775409 - 22775509
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||| |||||||||| ||||||||||||||| | |||| ||| | |||||||| | |||||||||  ||| |||||||  ||||| ||||| ||||    
22775409 tggttgggtctaacacaacaccacaaaatcggcttataaggtaaggatagcccccacctttaaacacatgttcaagccatcttttatccaatgtgggact 22775508  T
249 c 249  Q
    |    
22775509 c 22775509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 37246666 - 37246749
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    |||||||||| |||||||| ||||||||||  ||| |||||||| ||||||||||||| |   ||||||||||||| ||| ||||||    
37246666 tcttagaaatcgtggttggacctaacacaattccataaaatcggtttgtgaggtgaggat---ccccacttataaatacactgtcag 37246749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 8142646 - 8142765
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| | |||||||||||||||||||| ||  |||| ||| |||  || |||| | ||||||||| ||||||||  ||||||  |||    
8142646 tcttagaaatcgtggttagacctaacacaaccccacaaaaccgatttgtaaggcgagaattacccctatttataaacatattgtcagatcatctcacatc 8142745  T
237 cgatgtgtgactcttaacac 256  Q
    |||| |  ||||||||||||    
8142746 cgatataagactcttaacac 8142765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 198 - 257
Target Start/End: Original strand, 19954278 - 19954337
Alignment:
198 gcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacacc 257  Q
    ||||| ||||||||||| |||||||| |||||||||||  |||||| |||||||||||||    
19954278 gcccctacttataaacatattgtcagaccatctcctataagatgtgggactcttaacacc 19954337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 23607613 - 23607663
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    |||||||||||||||| |||||||||| | ||||||||||||||||||||||    
23607613 tagaaatggtggttgg-cctaacacaatctcacaaaatcggcttgtgaggtg 23607663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 24475980 - 24475925
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    ||||||||||| ||||||||||| |||||| ||| |||||||| ||||||||||||    
24475980 ttcttagaaattgtggttgggcccaacacatccctacaaaatcagcttgtgaggtg 24475925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 143 - 194
Target Start/End: Original strand, 32215520 - 32215571
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||| |||||||||||||||||||| |||||||| |||||||| ||||||||    
32215520 aaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgagg 32215571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 161 - 256
Target Start/End: Original strand, 52724009 - 52724104
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||| || |||||||||  || |||||||||| ||||||| | ||||||||| ||||| ||   |||| |||||||||||| ||||||||||||    
52724009 acacaatcctacaaaatcgatttatgaggtgaggattgccccaatttataaacatattgttagattatcttctatccgatgtgggactcttaacac 52724104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 169 - 252
Target Start/End: Complemental strand, 52994831 - 52994748
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctta 252  Q
    ||||||||||||||||||| || ||| ||| | | ||||||||||||||||||||  ||| |||||| ||||||| ||| ||||    
52994831 ccacaaaatcggcttgtgatgtaaggattgtctcaacttataaacacattgtcagatcatgtcctattcgatgtgagacactta 52994748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 1681768 - 1681686
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    |||||||||| ||||||| ||||||||| ||||| | || | |||||||||||||||||  | |||||||||  |||||||||    
1681768 taacacaacctcacaaaaccggcttgtggggtgatgattacacccacttataaacacatgtttaggccatcttttatccgatg 1681686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 1353531 - 1353478
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||| ||| ||||||||||||||||||||||||||||| ||| |||| ||||||    
1353531 ttaggaatcgtggttgggcctaacacaaccccacaaaaccggtttgtaaggtga 1353478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 515 - 580
Target Start/End: Complemental strand, 13354483 - 13354418
Alignment:
515 tcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtctatccaaaacagaagtcattac 580  Q
    |||||| ||||| || || |||| ||||||  |||||||||||||||| |||||||||||||||||    
13354483 tcttgcatcaccgactaaccctagaccagagccaggtgcaggtctatctaaaacagaagtcattac 13354418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 163 - 232
Target Start/End: Original strand, 13740888 - 13740957
Alignment:
163 acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    ||||||| ||||||  |||||||||||||| | || ||||||||| |||||| |||||||| ||||||||    
13740888 acaacccaacaaaaatggcttgtgaggtgatgatttcccccacttgtaaacatattgtcagaccatctcc 13740957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Complemental strand, 20303054 - 20303013
Alignment:
214 acattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||| |||||||||||||| |||||||||||    
20303054 acattgtcaggccatgtcctatccgatgtgggactcttaaca 20303013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 29215590 - 29215707
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||| ||||||||| | | | ||||  ||||| |||  ||||| ||||||||||||||||||| ||||||   |||||| |||||      
29215590 ttagaaatcgtggttggacctaacacagctctataaaactggcttatgatatgaggattgcccccacttataaacatattgtcgtaccatcttctatcta 29215689  T
239 atgtgtgactcttaacac 256  Q
    ||||  ||||||||||||    
29215690 atgttggactcttaacac 29215707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 204 - 256
Target Start/End: Complemental strand, 34992860 - 34992807
Alignment:
204 acttataaacacatt-gtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||||| ||||| ||||| ||||||||||||| ||||||||||||    
34992860 acttataaacacatttgtcagaccatcacctatccgatgtgggactcttaacac 34992807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 21717348 - 21717428
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| ||||||||||| ||||||||| ||||||| || ||||| ||||   | || |||||||||||||| ||||    
21717348 tcttagaaattgtggttgggccgaacacaacctcacaaaaccgacttgtaaggtagagattacccccacttataaatacat 21717428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 42420909 - 42420829
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| |||| | ||||| ||||||||| ||||||  || |||| |||||| | |||| |||||||||||||||||    
42420909 tcttagaaatcgtggataggcctgacacaaccctacaaaactggtttgtaaggtgaagattgctcccacttataaacacat 42420829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 46794074 - 46794034
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||||||||||||||||||| ||||||| ||||||||||    
46794074 ccacttataaacacattgtcagaccatctcttatccgatgt 46794034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 143 - 230
Target Start/End: Original strand, 8487518 - 8487604
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    |||| |||||||| ||||||||||| ||| || | | ||||||||||||||| |||  |||||||||||||||||  ||| |||||||    
8487518 aaattgtggttggacctaacacaactccagaataccagcttgtgaggtgaggattg-tcccacttataaacacatgttcatgccatct 8487604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 194
Target Start/End: Complemental strand, 11590088 - 11590033
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||| | |||||||||||||| |||| |||| |||| |||||||||||||||||    
11590088 ttagaagttgtggttgggcctaatacaatcccataaaaccggcttgtgaggtgagg 11590033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 228
Target Start/End: Original strand, 17001253 - 17001332
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    ||||||||| ||||| || | ||||||| ||  || ||| |||||| |||| ||||||||||| ||||||||||||||||    
17001253 tggttgggcataacataatctcacaaaaccgttttatgaagtgaggattgctcccacttataatcacattgtcaggccat 17001332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 231
Target Start/End: Original strand, 44576253 - 44576348
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||||||||| |||||||||  |||||||| ||||||||| ||| ||||| || | || || ||| ||||||||||||  |  ||||||||||||    
44576253 ttcttagaaatcgtggttgggtgtaacacaaacccacaaaaccggtttgtgcggcgcggatttcccacacttataaacatttattcaggccatctc 44576348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 47684572 - 47684498
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| ||||| || ||||||||||||||||||| ||  | ||||||||||  |||| ||||| ||||||||||||    
47684572 ttgtaaggtggggattgcccccacttataaacatatctttaggccatctctcatccaatgtgggactcttaacac 47684498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 272433 - 272490
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    ||||||| ||||||||| |||||| ||||||||||| | ||| || ||||||||||||    
272433 cctaacataaccccacacaatcggtttgtgaggtgatgattgtcctcacttataaaca 272490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 191 - 236
Target Start/End: Complemental strand, 1800068 - 1800023
Alignment:
191 gagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||| |||||||||||||||||||||||||  ||||||||| ||||    
1800068 gaggattgcccccacttataaacacattgtttggccatctcttatc 1800023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 170
Target Start/End: Complemental strand, 27086726 - 27086693
Alignment:
137 tcttagaaatggtggttgggcctaacacaacccc 170  Q
    |||||||||| |||||||||||||||||||||||    
27086726 tcttagaaatcgtggttgggcctaacacaacccc 27086693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 196 - 225
Target Start/End: Complemental strand, 27783089 - 27783060
Alignment:
196 ttgcccccacttataaacacattgtcaggc 225  Q
    ||||||||||||||||||||||||||||||    
27783089 ttgcccccacttataaacacattgtcaggc 27783060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 230
Target Start/End: Original strand, 29215814 - 29215906
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    ||||||||||  ||||| | ||||||||  ||||||||||  ||| |||||||||||| ||  | |||||||||||||||||||| | ||||||    
29215814 tcttagaaatcatggttagacctaacacg-ccccacaaaactggcatgtgaggtgaggattatcaccacttataaacacattgtcggaccatct 29215906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 35018560 - 35018483
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||| | ||||||||||||||| | |||  |||||  | |||||| |||||||| | |||||||||||||||||    
35018560 tcttagaatttgtggttgggcctaactcgaccttacaaacccagcttgtaaggtgaggatggcccccacttataaaca 35018483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 218
Target Start/End: Original strand, 40765700 - 40765781
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacatt 218  Q
    |||||||||| || ||  ||| ||||||||| |||||||||| | |||||| |||| | |||||| || |||||||||||||    
40765700 tcttagaaattgtagtaaggcttaacacaacaccacaaaatcagattgtgatgtgaagattgccctcaattataaacacatt 40765781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 46794319 - 46794246
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttata 210  Q
    |||||||||| ||| || || |||||| || ||||||||| || |||||  ||||||| |||||||||||||||    
46794319 tcttagaaatcgtgattaggtctaacataatcccacaaaaccgacttgtagggtgaggattgcccccacttata 46794246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 139 - 171
Target Start/End: Complemental strand, 21833431 - 21833399
Alignment:
139 ttagaaatggtggttgggcctaacacaacccca 171  Q
    |||||||| ||||||||||||||||||||||||    
21833431 ttagaaatcgtggttgggcctaacacaacccca 21833399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 152 - 255
Target Start/End: Complemental strand, 29089920 - 29089816
Alignment:
152 ttgggcctaacacaaccccacaaaatcgg-cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    ||||| |||||||||| |||||||| | | |||||||  ||| | ||||| ||| ||||||| ||||| |||||| ||| | |||| |||||| ||||||    
29089920 ttgggtctaacacaactccacaaaacctgacttgtgaaatgatgattgcctccagttataaatacattttcaggctatcacatatcagatgtgagactct 29089821  T
251 taaca 255  Q
    |||||    
29089820 taaca 29089816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 46854109 - 46854057
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgagg 189  Q
    |||||||||| | ||| ||| |||||||||||||||||||  |||||||||||    
46854109 tcttagaaattgaggtcgggtctaacacaaccccacaaaactggcttgtgagg 46854057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 100; Significance: 4e-49; HSPs: 135)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 39902562 - 39902681
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
39902562 tcttagaaatggtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatc 39902661  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
39902662 cgatgtgggactcttaacac 39902681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 28245527 - 28245644
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||    
28245527 ttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccg 28245626  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
28245627 atgtgagactcttaacac 28245644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 35788979 - 35788859
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||| | |||||    
35788979 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttctatc 35788880  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||||||||    
35788879 cgatgtgggactcttaacacc 35788859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 134 - 256
Target Start/End: Complemental strand, 21498883 - 21498761
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||    
21498883 gattattagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcct 21498784  T
234 atccgatgtgtgactcttaacac 256  Q
    | |||||||| ||||||||||||    
21498783 aaccgatgtgggactcttaacac 21498761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 22827623 - 22827509
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||    
22827623 tcttagaaatcgtggttgggcctaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacgttgtcaggccatctcctatc 22827524  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
22827523 cgatgtgggactctt 22827509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 22863559 - 22863441
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||| || ||    
22863559 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacacattgtcaggccatcttctgtc 22863460  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
22863459 cgatgtgagactcttaaca 22863441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 35788744 - 35788626
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
35788744 tcttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatc 35788645  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
35788644 tgatgtgggactcttaaca 35788626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 50543566 - 50543684
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||    
50543566 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacacattgtcaggccatcacctatc 50543665  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
50543666 cgatgtgggactcttaaca 50543684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 136 - 255
Target Start/End: Complemental strand, 21685084 - 21684965
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||   |||||||||||||||||||||||||||| ||||||    
21685084 ttcttagaaattgtggttgggcttaacacaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaacacattgtcaggccatgtcctat 21684985  T
236 ccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||    
21684984 ccgatgtgagactcttaaca 21684965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 22845446 - 22845564
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| || ||||    
22845446 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcatatc 22845545  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
22845546 tgatgtgggactcttaaca 22845564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 53828522 - 53828640
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||| |||||| |    
53828522 tcttagaaattgtggttgggcctaacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaac 53828621  T
237 cgatgtgtgactcttaaca 255  Q
    |||||||  ||||||||||    
53828622 cgatgtggaactcttaaca 53828640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 21498437 - 21498321
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
21498437 ttagaaatcgtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 21498338  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
21498337 atgtgggactcttaaca 21498321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 53828287 - 53828407
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||| |||||||||||| ||||||     
53828287 ttcttagaaattgtgattgggcctaacacaaccccacaaaatcggtttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaa 53828386  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
53828387 ccgatgtgggactcttaacac 53828407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 22231072 - 22231191
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| ||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||    
22231072 tcttagaaatcgtggttggacctaatacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcctatc 22231171  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  ||||||||||||    
22231172 cgatgtaggactcttaacac 22231191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 50543329 - 50543448
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||| |||||||||||| ||||| ||||||    
50543329 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatcacctatc 50543428  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| | ||||||||||    
50543429 cgatgtggggctcttaacac 50543448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 11036745 - 11036863
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| |||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||    
11036745 tcttaaaaattgtggttaggcctaacacaaccccacacaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 11036844  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||   ||||||||||    
11036845 cgatgttgtactcttaaca 11036863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 150 - 255
Target Start/End: Complemental strand, 9279299 - 9279194
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    ||||||||||||||||||||||||||| ||||| ||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||| |||||    
9279299 ggttgggcctaacacaaccccacaaaaccggctagtgaggtgatgattgcccccacttataaacacattgtcaggccatcacctatccgatgtgcgactc 9279200  T
250 ttaaca 255  Q
    ||||||    
9279199 ttaaca 9279194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 20822056 - 20821939
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||  ||||||||||||||||||| |||||||||||| |||||| |||    
20822056 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccg 20821957  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
20821956 atgtgggactcttaacac 20821939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 35796741 - 35796860
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||| | |||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| ||    
35796741 tcttagaaatggtggttggacttaacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctgtc 35796840  T
237 cgatgtgtgactcttaacac 256  Q
    |||||||  |||||||||||    
35796841 cgatgtggaactcttaacac 35796860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 25052935 - 25052819
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||||||| || || |||||||||||||||| ||||||||||||  ||||| |||    
25052935 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaacaaattgtcaggccaattcctaaccg 25052836  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
25052835 atgtgggactcttaaca 25052819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 53814930 - 53815046
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||| |||||||||||||||||| || |||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
53814930 ttagaaatcgtggttgggcttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 53815029  T
239 atgtgtgactcttaaca 255  Q
    |||||  ||||||||||    
53815030 atgtggaactcttaaca 53815046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 22231307 - 22231426
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| | ||| ||||| ||| || ||||    
22231307 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatatattctcaggtcatatcatatc 22231406  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  ||||||||||||    
22231407 cgatgtaggactcttaacac 22231426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 1518249 - 1518131
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||| || |||||| |    
1518249 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgagctgaggattgcccccacttataaacaaattgtcaggtcaactcctaac 1518150  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| ||||| |||||    
1518149 cgatgtgggactcataaca 1518131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 139 - 257
Target Start/End: Complemental strand, 9685715 - 9685597
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||| ||||| || ||| |||||| |||    
9685715 ttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaaccg 9685616  T
239 atgtgtgactcttaacacc 257  Q
    ||| | |||||||||||||    
9685615 atgcgggactcttaacacc 9685597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 52559652 - 52559534
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||| ||| || ||||    
52559652 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatgtcatatc 52559553  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||| ||||||    
52559552 caatgtgagacttttaaca 52559534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 400566 - 400682
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| || |||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||| ||||||| |||| |    
400566 ttagaaattgtggttgagcttaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcagaccatctcatatctg 400665  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
400666 atgtgagactcttaaca 400682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 5846229 - 5846113
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| ||||||| ||||||||||||| |||||| |||||||||| ||||||||||||||||||| |||||||| ||| |||||| |||    
5846229 ttagaaatcgtggttgagcctaacgcaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccg 5846130  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
5846129 atgtgagactcttaaca 5846113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 37836165 - 37836049
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||| |||||||| ||| |||| ||||||||||||||||| ||||||| ||||||| |||| ||    
37836165 tcttagaaattgtggttaggcctaacacaaccccacaaaaccggcttgtaaggagaggattgcccccacttataaatacattgttaggccatgtcctgtc 37836066  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
37836065 cgatgtgggactcttaa 37836049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 6218524 - 6218405
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||  ||| |||| ||||||||||||||| | ||||||||||||||||||||||||| ||| |||||||||||    
6218524 tcttagaaatcgtggttgagcctaacacaattccataaaaccggcttgtgaggtgatgattgcccccacttataaacacattgttaggtcatctcctatc 6218425  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
6218424 tgatgtgagactcttaacac 6218405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 154 - 257
Target Start/End: Original strand, 27634097 - 27634200
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||| || ||  |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||    
27634097 gggcctaactcatccttacaaaatcggtttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaa 27634196  T
254 cacc 257  Q
    ||||    
27634197 cacc 27634200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 35796976 - 35797095
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||| ||||||| ||||||||||||||||||  || ||||||||||||| ||||||||||||||||||| ||||||| | |||||||| ||    
35796976 tcttagaaatggtagttgggcttaacacaaccccacaaaactggtttgtgaggtgaggattgcccccacttataaacatattgtcatgtcatctcctgtc 35797075  T
237 cgatgtgtgactcttaacac 256  Q
    |||| || ||||||||||||    
35797076 cgatatgggactcttaacac 35797095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 136 - 251
Target Start/End: Original strand, 44118857 - 44118972
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||| |||| ||||| ||  |||||||||||||||||||  |||||||||||||||| || ||||||||||||||||||||||||||||||||| |||    
44118857 ttcttataaatcgtggtgggctctaacacaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttat 44118956  T
236 ccgatgtgtgactctt 251  Q
    |||||||| |||||||    
44118957 ccgatgtgggactctt 44118972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 35819127 - 35819245
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||||||||||||||| |||||||  ||||||||||| |||| |||||||||| |||||||| |||||||||||| |||||| |    
35819127 tcttaaaaatcgtggttgggcctaacacaacctcacaaaactggcttgtgaggcgaggattgcccccacatataaacaaattgtcaggccaactcctaac 35819226  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
35819227 cgatgtgggactcttaaca 35819245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 9685481 - 9685365
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||| ||||||| || |||||||||||||| ||| ||||||||||||||| ||||| |||||| |||||| |||    
9685481 ttagaaatcgtggttgggcctaacacaacctcacaaaaccgacttgtgaggtgaggattggccccacttataaacaaattgttaggccaactcctaaccg 9685382  T
239 atgtgtgactcttaaca 255  Q
    ||||  |||||||||||    
9685381 atgtaggactcttaaca 9685365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 14783188 - 14783304
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||| || ||||||||| ||||||||  || |||||| |||    
14783188 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccg 14783287  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
14783288 atgtgggactcttaaca 14783304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 35175119 - 35175004
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| | || ||||| |||||||||||||||||||||||| | || ||    
35175119 tcttagaaatg-tggttgggcctaacacaaccctacaaaatcgacttgtgaggtgatgattaccccctcttataaacacattgtcaggccatgttctgtc 35175021  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
35175020 cgatgtgggactcttaa 35175004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 54054806 - 54054922
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||| |||||||||  ||||||||||||||||||| ||||| ||| || ||||||  ||    
54054806 ttagaaatcgtggttgggcctaacacaaccccacaaaaacggcttatgaggtgagaattgcccccacttataaacaaattgttaggtcaactcctaatcg 54054905  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
54054906 atgtgggactcttaaca 54054922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 11036510 - 11036629
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||||| ||||| ||||||||||||||| | ||||||| ||||||||||||||||||| | |||| ||||||    
11036510 tcttagaaattgtggttgggtctaacacaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaacacattgtcatgtcatcacctatc 11036609  T
237 cgatgtgtgactcttaacac 256  Q
     ||| || ||||||||||||    
11036610 tgatttgggactcttaacac 11036629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 152 - 255
Target Start/End: Original strand, 35645779 - 35645882
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||||||| | ||||  |||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||| ||||||| |||||||    
35645779 ttgggcctaacacaaccctaaaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctattcgatgtgggactctt 35645878  T
252 aaca 255  Q
    ||||    
35645879 aaca 35645882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 40717440 - 40717559
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| || ||| |||||||||| ||||||||||||||||||| ||| |||||||| |||| | |    
40717440 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaacaaattatcaggccaactcccaac 40717539  T
237 cgatgtgtgactcttaacac 256  Q
     ||||||  |||||||||||    
40717540 tgatgtggaactcttaacac 40717559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 6218289 - 6218175
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| | |||||||||| |||||||| || |||||||||||| | ||||||||||||||||||| ||||| | |||||||||||||    
6218289 tcttagaaatcgtggttgtgtctaacacaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaacatattgtgaagccatctcctatc 6218190  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
6218189 cgatgtgagactctt 6218175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 154 - 256
Target Start/End: Original strand, 31254423 - 31254525
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||| || || ||||||| ||| |||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||    
31254423 gggcctaactcatcctcacaaaaccggtttgtaaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaa 31254522  T
254 cac 256  Q
    |||    
31254523 cac 31254525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 18528216 - 18528336
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||  |||||||||||| |||||||||  ||||||||||||| ||||| |||||||||||||||||| || |||||||| |||     
18528216 tcttagaaatcgtggttggatctaacacaaccctacaaaatcgatttgtgaggtgaggattgccgccacttataaacacattgccatgccatctcgtatt 18528315  T
237 cgatgtgtgactcttaacacc 257  Q
     |||||| |||||||||||||    
18528316 tgatgtgagactcttaacacc 18528336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 27634549 - 27634633
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||    
27634549 acaaaaccggcttgtgaggtgaggattgcccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 27634633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 35609488 - 35609608
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||  | |||||||||||||||| || |||||||||||||| |||||||||||||||||||| |  | ||||||||||| ||    
35609488 ttcttagaaatcgtggttgggtgttacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacacttgtttaggccatctcccat 35609587  T
236 ccgatgtgtgactcttaacac 256  Q
    || ||||| ||||||||||||    
35609588 ccaatgtgggactcttaacac 35609608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 139 - 239
Target Start/End: Original strand, 53814675 - 53814775
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||| ||  ||||||||||||||| |||||||||||| |||||| |||    
53814675 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattatccccacttataaacaaattgtcaggccaactcctagccg 53814774  T
239 a 239  Q
    |    
53814775 a 53814775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 5398475 - 5398593
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||| |||||||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||||||| |||||||  | | ||    
5398475 tcttagaaatcatggttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccagttataaacacattgttaggccatgacttgtc 5398573  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
5398574 cgatgtgggactcttaacac 5398593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 12869028 - 12869147
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || |||  ||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||| |||||||||||| || ||| |    
12869028 tcttagaaatcgtagtttagcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaggccaactgctaac 12869127  T
237 cgatgtgtgactcttaacac 256  Q
     |||||  ||||||||||||    
12869128 tgatgtaggactcttaacac 12869147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 139 - 234
Target Start/End: Complemental strand, 16066148 - 16066053
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||||||||||||||||||| || |||||| | | ||||||||||||| ||||||||||||||||||| |||||||||||| ||||||    
16066148 ttagaaatggtggttgggcctaacacaatcctacaaaaccagtttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactccta 16066053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 17111853 - 17111734
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| |||||||||||| || ||||||||||| ||| |||| |  |  |||||||||||||||||||||||||||||| ||||||    
17111853 tcttagaaattgtggttggacctaacacaacctcataaaatcggcttttgaagtgatgaataaccccacttataaacacattgtcaggccatcacctatc 17111754  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
17111753 tgatgtgggactcttaacac 17111734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 139 - 225
Target Start/End: Complemental strand, 2463889 - 2463803
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggc 225  Q
    ||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||| ||| ||||||||||    
2463889 ttagaaatggtggctgggcctaacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttatacacaaattgtcaggc 2463803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 52559891 - 52559770
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||||||||  ||||||||||||| |||| || |||||| ||||||||||||||||  |||| |||||||||||||||||||||| | ||| |||||    
52559891 attcttagaaatcatggttgggcctaatacaatcctacaaaaccggcttgtgaggtgagaattgctcccacttataaacacattgtcaagtcatgtccta 52559792  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| || | |||||||    
52559791 tccgatgtgggatttttaacac 52559770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 136 - 207
Target Start/End: Original strand, 53559288 - 53559359
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||    
53559288 ttcttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccactt 53559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 7926643 - 7926529
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||||||||  ||  ||||||| ||||||||||||| ||||||||  |||||||||||  | ||    
7926643 tcttagaaatcatggttgggcctaacacaaccccacaaaatcggcacgtagggtgaggattgcccccacttacaaacacatgttcaggccatcttttgtc 7926544  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
7926543 cgatgtgggactctt 7926529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 219
Target Start/End: Original strand, 28073180 - 28073262
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattg 219  Q
    |||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||| |||| ||||||    
28073180 tcttagaaattgtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagggttgcctccacttgtaaatacattg 28073262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 5846430 - 5846345
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||| |||||| |||||||| ||||||||||||    
5846430 acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaacac 5846345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 162 - 251
Target Start/End: Original strand, 27464272 - 27464361
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||  ||||| ||||||||||| |||||||    
27464272 cacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacactttgtcaggaaatctcttatccgatgtgggactctt 27464361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 138 - 256
Target Start/End: Original strand, 45784870 - 45784996
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaa--------tcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    ||||||||||||||||||||||||||||||| |||||||        |||||||||||||||| | ||||| ||||||||||||| | ||||| | ||||    
45784870 cttagaaatggtggttgggcctaacacaacctcacaaaaccggtttgtcggcttgtgaggtgatgattgccgccacttataaacatactgtcaagtcatc 45784969  T
230 tcctatccgatgtgtgactcttaacac 256  Q
     ||||||||||||| ||||||||||||    
45784970 acctatccgatgtgggactcttaacac 45784996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 148 - 256
Target Start/End: Original strand, 5398222 - 5398329
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||||||||||||||||||||||||| ||||||||||| ||||| ||| |||| ||||||||||||||||||| ||||  | | ||| ||||| |||    
5398222 gtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattg-cccctcttataaacacattgtcagaccatgacttgtccaatgtgggac 5398320  T
248 tcttaacac 256  Q
    |||||||||    
5398321 tcttaacac 5398329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 2516284 - 2516167
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| |||||||||||||||||||| ||||| || |||||| | |||| |||||||||||||| ||||||||| ||||| ||| |    
2516284 tcttagaaattgtggttggacctaacacaaccccacaaaaccggctagt-aggtga-gattgctcccacttataaacatattgtcaggtcatcttctaac 2516187  T
237 cgatgtgtgactcttaacac 256  Q
    ||| ||| ||||||||||||    
2516186 cgaagtgggactcttaacac 2516167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 228
Target Start/End: Original strand, 12869262 - 12869353
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||||| ||||||||||||||||||||||||||||| || ||| |||||||||| ||| ||||||||||||| | ||||||| |||||    
12869262 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaataaattgtcaagccat 12869353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 34358029 - 34358116
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg 224  Q
    |||||||||| ||| ||| ||||||||||||||||||||| |||||| ||| |||||| ||||||||| |||||||||||||||||||    
34358029 tcttagaaatcgtgtttgagcctaacacaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaacacattgtcagg 34358116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 137 - 228
Target Start/End: Complemental strand, 4464380 - 4464286
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtga---ggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||| | ||||||||| |||||| |||||||||||||||||||||||   ||||||||||||||| | |||||||||||||||||| ||||    
4464380 tcttagaattcgtggttgggtctaacaaaaccccacaaaatcggcttgtgatccggtgagggttgcccctatttataaacacattgtcagaccat 4464286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 13555500 - 13555584
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||| ||||||||||||||||| || ||||||||||||| ||||||||||  ||||| ||||||||||||| |||||||||||    
13555500 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 13555584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 139 - 254
Target Start/End: Original strand, 2261754 - 2261869
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||||||||||  | ||||||||||||||||||  ||  |||||||||||| ||| ||||||||||||| | |||||||||||| |||||| ||     
2261754 ttagaaatggtggttgaacttaacacaaccccacaaaactggtctgtgaggtgaggattgtccccacttataaataaattgtcaggccacctcctaacca 2261853  T
239 atgtgtgactcttaac 254  Q
    ||||| |||| |||||    
2261854 atgtgagacttttaac 2261869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 163 - 222
Target Start/End: Original strand, 28246110 - 28246169
Alignment:
163 acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||    
28246110 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtca 28246169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 36685874 - 36685992
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||| ||||||||||||||  | |||||||||||||| |  |||||| ||||||||||||||||||| ||| || |||     
36685874 tcttagaaatcgtggttgggtctaatacaaccccacaaaactgacttgtgaggtgaggataacccccatttataaacacattgtcaggtcatttcatat- 36685972  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
36685973 tgatgtgggactcttaacac 36685992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 149 - 243
Target Start/End: Complemental strand, 7926401 - 7926307
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||||||||||||| |||||||||| |||||||||  ||||||  |||||||||||||||||||||  |||||||||||  | |||||||||    
7926401 tggttgggcctaacacagccccacaaaaccggcttgtgttgtgaggaatgcccccacttataaacacatgttcaggccatcttttgtccgatgtg 7926307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 35609710 - 35609788
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||  |||||||| || |||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||    
35609710 tcttagaaatcatggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacac 35609788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 231
Target Start/End: Original strand, 50870480 - 50870573
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||||||||| |||||||| ||||||||||||||||||||||||| |  |||||||||  ||||||||||||||||||| |  ||||||||||||    
50870480 tcttagaaattgtggttggacctaacacaaccccacaaaatcggc-taagaggtgaggactgcccccacttataaacacttgttcaggccatctc 50870573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 143 - 256
Target Start/End: Original strand, 21750047 - 21750160
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||| | |||||| |||||||||||| |||||||||||||||||  ||| |||||||||||| | |||||||   |||||| ||||||||||    
21750047 aaattgtggttgagtctaacataaccccacaaaaccggcttgtgaggtgaggaatgctcccacttataaagatattgtcatatcatctcttatccgatgt 21750146  T
243 gtgactcttaacac 256  Q
    | |||| |||||||    
21750147 gagacttttaacac 21750160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 149 - 248
Target Start/End: Complemental strand, 20253584 - 20253484
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg-ccatctcctatccgatgtgtgac 247  Q
    ||||||| ||||||||| |||||||||||| || |||||||||| |||||   |||||||||||||||||||||||  |||||| ||||||||||| |||    
20253584 tggttggacctaacacagccccacaaaatcagcatgtgaggtgatggttgttgccacttataaacacattgtcaggatcatctcttatccgatgtgagac 20253485  T
248 t 248  Q
    |    
20253484 t 20253484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 40726806 - 40726734
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttat 209  Q
    |||||||||| ||||||||||||||||||| || |||||| ||||||||||||||||| || |||||||||||    
40726806 tcttagaaatcgtggttgggcctaacacaatcctacaaaaccggcttgtgaggtgaggatttcccccacttat 40726734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 54055039 - 54055149
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||  |||||||||||||||||     ||||||| ||||||||||| ||||| ||||||||||||||||||| ||||| |||||| || ||| |||    
54055039 ttagaaagcgtggttgggcctaacac-----cacaaaa-cggcttgtgagatgaggattgcccccacttataaacaaattgttaggccaacttctaaccg 54055132  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
54055133 atgtgggactcttaaca 54055149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 180 - 255
Target Start/End: Original strand, 980092 - 980167
Alignment:
180 gcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||| |||||||| |||||||||||    
980092 gcttgtgaggtgaggattgcccccacttataaacaaattctcaggtcaactcctaaccgatgtgggactcttaaca 980167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 170 - 256
Target Start/End: Original strand, 7806613 - 7806699
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||||||| ||||| ||||||| ||| |||||||||||||| |||||| |||||||| ||| ||| ||||    
7806613 cacaaaaccggcttgtgaggtgaggattgccgccacttaaaaatacattgtcaggccaactcctaaccgatgtgggacactttacac 7806699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 17111648 - 17111531
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| | | || | |||||||| ||| |||||||||||||| || |||  | ||||| ||||||    
17111648 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagtttttaaggtgaggattg-ccccacttataaactcactgtaggaccatcacctatc 17111550  T
237 cgatgtgtgactcttaaca 255  Q
    |||| ||  ||||||||||    
17111549 cgatatgaaactcttaaca 17111531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 18528456 - 18528574
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||| || | ||||||| ||  ||||||||||||| ||||||||| || | ||||||||||||  | ||||||| ||    
18528456 tcttagaaatcgtggttgggtctaacaaaatctcacaaaaccgatttgtgaggtgaggattgcccccaattgttaacacattgtcacactatctcctgtc 18528555  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||| ||||||    
18528556 cgatgtgagacttttaaca 18528574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 41187931 - 41188045
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||| |||| ||||||||||||| |  |||||||||||||| |||||   ||||||||| |||||||||| ||||||   |||    
41187931 tcttagaaatcgtggttgggcataactcaaccccacaaaaccaacttgtgaggtgaggattgcctttacttataaatacattgtcagaccatctttaatc 41188030  T
237 cgatgtgtgactctt 251  Q
    | ||||| |||||||    
41188031 caatgtgggactctt 41188045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 11103897 - 11104014
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||| | ||||| |||||||||| |||| |||| | | |||||| |||||| ||| ||| | ||||||| | |||||||||||| |||||| |||    
11103897 ttagaaatgatagttggacctaacacaatcccaaaaaaccagtttgtgaagtgaggattgtccctatttataaataaattgtcaggccaactcctaaccg 11103996  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
11103997 atgtgggactcttaacac 11104014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 139 - 243
Target Start/End: Complemental strand, 26549720 - 26549615
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgc-ccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||  || |||| ||| ||||||| |||||||| ||||||||||| | ||| || | |||||||||||||||||| ||||||||||||| |||||    
26549720 ttagaaatcatgattggacctgacacaacaccacaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatcc 26549621  T
238 gatgtg 243  Q
    ||||||    
26549620 gatgtg 26549615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 158 - 251
Target Start/End: Complemental strand, 53699091 - 53698998
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||| ||| |||| ||||||||||||| |||||| |||||||||||| ||||||||  |||||| ||| || |||| |||||||    
53699091 ctaacacaaccccataaagtcggtttgtgaggtgaggattgcccacacttataaacatattgtcagatcatctcttattcgttgtgggactctt 53698998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 136 - 253
Target Start/End: Original strand, 10361997 - 10362116
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtc--aggccatctcct 233  Q
    ||||||||||| || ||||||||||||| |||||||||| | | |||||| |||||| | |||| || ||||||||||||| ||||  ||| ||| || |    
10361997 ttcttagaaattgtagttgggcctaacataaccccacaataccagcttgtaaggtgatgattgctcctacttataaacacactgtcagaggtcatgtcat 10362096  T
234 atccgatgtgtgactcttaa 253  Q
    |||||||||| |||||||||    
10362097 atccgatgtgagactcttaa 10362116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 151 - 251
Target Start/End: Original strand, 12005482 - 12005582
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    |||||| ||||||||||| ||||||| ||||||||||||||||| |||||||||||||| |||| ||  ||| ||||| |  | ||||||||| ||||||    
12005482 gttgggtctaacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttattaacaaatgttcatgccatattttgtccgatgtgggactct 12005581  T
251 t 251  Q
    |    
12005582 t 12005582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 22445537 - 22445415
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacat---tgtcaggccatctcc 232  Q
    |||||||| | ||||||||| ||||||||||||||||||| || |||||  ||||||| ||| |||||||| ||||||||||   ||||||  |||||||    
22445537 tcttagaatttgtggttgggtctaacacaaccccacaaaaccgacttgtagggtgaggattgccccccactaataaacacattaatgtcagatcatctcc 22445438  T
233 tatccgatgtgtgactcttaaca 255  Q
    |||| ||| || |||||||||||    
22445437 tatcagatatgagactcttaaca 22445415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 252
Target Start/End: Original strand, 30566044 - 30566148
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    |||||||||| |||||||| || ||||||  ||||| ||| |||||  |||| |||||||||||||||||||||||| | |||||| |  ||||||||||    
30566044 gtggttgggcttaacacaaacctacaaaactggcttatgatgtgagaattgctcccacttataaacacattgtcaggtcttctcctgtttgatgtgtgac 30566143  T
248 tctta 252  Q
    |||||    
30566144 tctta 30566148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 137 - 232
Target Start/End: Original strand, 6666634 - 6666729
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    |||||||||| |||||||||||||| |||| ||||||||| ||| ||||||||| ||| ||||||||||||  |||||| |  |||| ||||||||    
6666634 tcttagaaatcgtggttgggcctaaaacaatcccacaaaaccggtttgtgaggtaaggattgcccccacttgaaaacacttgttcagaccatctcc 6666729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 22822435 - 22822356
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacaca 216  Q
    |||||||| | |||||||| ||||| |||||| ||||||| ||||||||| ||||||| || ||||||||||||||||||    
22822435 tcttagaatttgtggttggacctaatacaaccgcacaaaaccggcttgtgtggtgaggatttcccccacttataaacaca 22822356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 24513361 - 24513431
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttata 210  Q
    |||||||| ||| |||||||||||||||||| |||||  ||||||||||||||||| |||||||||||||||    
24513361 ttagaaatcgtgattgggcctaacacaaccctacaaac-cggcttgtgaggtgaggattgcccccacttata 24513431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 158 - 255
Target Start/End: Original strand, 6778681 - 6778779
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt-ataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||| |||||  |||||| ||||||||||||||||| ||| | || ||| |||||| |||||||||||||| || ||||||||||| |||||||||||    
6778681 ctaactcaaccttacaaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaaca 6778779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 25323797 - 25323875
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| | || |||||| ||||||||||||||||||| |||| || ||||||||| |||||||||| |||||||||    
25323797 tcttagaatttgtagttgggactaacacaaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaacac 25323875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 136 - 257
Target Start/End: Original strand, 13555245 - 13555366
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||||  ||||||||  |||||||| |||| |||| | || |||||||||||| ||||  ||||| ||||| ||| |||||| |||||  ||||    
13555245 ttcttagaaatcctggttgggtttaacacaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctat 13555344  T
236 ccgatgtgtgactcttaacacc 257  Q
    ||||||||  ||||||||||||    
13555345 ccgatgtggaactcttaacacc 13555366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 35485298 - 35485221
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||| ||||||||||||||||||| | || ||| ||||||||  ||||||||||||||||||||| | ||||||||    
35485298 gttgggtctaacacaaccccacaaaaccagcgtgtaaggtgaggactgcccccacttataaacacatagccaggccat 35485221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 171 - 243
Target Start/End: Original strand, 2221001 - 2221073
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    |||||| ||||||||||||||||| |||||||||| |||||||||||  | |||||||||| |||| ||||||    
2221001 acaaaaccggcttgtgaggtgaggattgcccccacctataaacacatatttaggccatctcttatctgatgtg 2221073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 139 - 243
Target Start/End: Complemental strand, 13637472 - 13637368
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||| || | |||||||||||||| |   |||||| |||| | ||||||| ||||||||||||||||||| | |||||| ||| ||    
13637472 ttagaaatcgtggttgggtcttagacaaccccacaaaaccaaattgtgaagtgaagattgcccctacttataaacacattgtcaagtcatctcttattcg 13637373  T
239 atgtg 243  Q
    |||||    
13637372 atgtg 13637368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 161 - 237
Target Start/End: Original strand, 25324056 - 25324132
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||||||||||||| ||||||||||||   |||||||||||||||||||| |  || ||||||||| |||||    
25324056 acacaaccccacaaaatcgacttgtgaggtgataattgcccccacttataaacacttgttctggccatctcttatcc 25324132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 17222668 - 17222727
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    |||||||||||| ||  |||||| ||||||||||||||||| ||||||||||||||||||    
17222668 gggcctaacacatccttacaaaaccggcttgtgaggtgaggattgcccccacttataaac 17222727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 136 - 255
Target Start/End: Complemental strand, 20095378 - 20095259
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||||  ||| |||| |||||||||||| ||||||  || ||||||||||  | ||| ||||| || |||||||||| ||| |||||||  |||    
20095378 ttcttagaaatcatgggtgggtctaacacaacccaacaaaactggtttgtgaggtggagattgtccccatttctaaacacattatcatgccatctattat 20095279  T
236 ccgatgtgtgactcttaaca 255  Q
    | |||||| |||||||||||    
20095278 ctgatgtgagactcttaaca 20095259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 256
Target Start/End: Complemental strand, 42662528 - 42662429
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||| |||| ||||||||| ||| ||||||| ||||  ||  ||| | |||||||||||||||||| ||||||||||| ||||||| || |||||||||    
42662528 cctaatacaatcccacaaaaccggtttgtgagatgagaattatccctatttataaacacattgtcagaccatctcctattcgatgtgggattcttaacac 42662429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 148 - 230
Target Start/End: Complemental strand, 8902701 - 8902619
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    |||||||| ||||||| ||||||||||||  ||||||||||| |||| ||||| ||||| ||||||||||  | |||||||||    
8902701 gtggttggacctaacataaccccacaaaactggcttgtgaggagaggattgcctccactaataaacacatgtttaggccatct 8902619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 157 - 255
Target Start/End: Original strand, 11783811 - 11783909
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||||| |   ||||||||||||| || |||| ||||||||||| ||||| | | ||| | |||| ||||||| |||||||||||    
11783811 cctaacacaaccccacaaaaccaatttgtgaggtgaggattacccctacttataaacaaattgtaaagtcattttctattcgatgtgagactcttaaca 11783909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 42684792 - 42684870
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| | ||| ||| ||||||| |||| |||||||| ||||||||||||||| | ||||||||| ||||||||||    
42684792 tcttagaacttgtgcttgagcctaactcaacgccacaaaaccggcttgtgaggtgatgattgcccccatttataaacac 42684870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 158 - 215
Target Start/End: Original strand, 6666220 - 6666277
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||||||||||| | | ||||||||||||| ||||||||| ||||||||||    
6666220 ctaacacaaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaacac 6666277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 230
Target Start/End: Original strand, 21646264 - 21646357
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    ||||| |||| |||||| || ||||||||||  |||||||  ||||||| |||||||| ||||||||| ||||||||||||  | |||||||||    
21646264 tcttaaaaattgtggttaggtctaacacaacatcacaaaactggcttgtaaggtgaggattgcccccatttataaacacatgtttaggccatct 21646357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 30565806 - 30565927
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||  |||||| |||| || ||||||   ||||||||  || |||||||||| || ||| |||||||||| ||||| |||| | |||| |||    
30565806 attcttagaaaacgtggtttggccaaatacaaccgtgcaaaatcgatttatgaggtgaggattaccctcacttataaatacattatcagacaatcttcta 30565905  T
235 tccgatgtgtgactcttaacac 256  Q
     |||||||| ||||||||||||    
30565906 cccgatgtgggactcttaacac 30565927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 148 - 189
Target Start/End: Original strand, 40716480 - 40716521
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgagg 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
40716480 gtggttgggcctaacacaaccccacgaaatcggcttgtgagg 40716521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 187 - 256
Target Start/End: Original strand, 40717255 - 40717324
Alignment:
187 aggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||| ||| ||||||||||||||||||||||||| ||| | || || |||||| ||||||||||||    
40717255 aggtgaggattgtccccacttataaacacattgtcaggtcatgttctgtctgatgtgggactcttaacac 40717324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 148 - 252
Target Start/End: Original strand, 13611759 - 13611863
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    |||||||| | |||| ||||||| ||||| |  |||||||||||||| ||  ||||||||||||| | |||||||| ||||| ||||||| |||||  ||    
13611759 gtggttggtcttaactcaaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaac 13611858  T
248 tctta 252  Q
    |||||    
13611859 tctta 13611863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 23209926 - 23209846
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| ||| ||||||||||| |||||| ||||| || |||||||| |||||| || | | |||||||||||||||    
23209926 tcttagaaatcgtgattgggcctaactcaaccctacaaattcagcttgtgatgtgaggattacactcacttataaacacat 23209846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 139 - 231
Target Start/End: Original strand, 1333508 - 1333602
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg--cccccacttataaacacattgtcaggccatctc 231  Q
    |||||||| ||||||||| |||| ||||||| |||||| || ||||||||||||||  ||  |||||||||| |||||| |  ||||||||||||    
1333508 ttagaaatcgtggttgggtctaatacaaccctacaaaaccgacttgtgaggtgaggactgctcccccacttacaaacacttgttcaggccatctc 1333602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 50859073 - 50858999
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||| ||||||||||||||  ||||||||||||||||| || | ||||||||||||||| |  ||||||||||||    
50859073 gcctagcacaaccccacaaac-cggcttgtgaggtgaggatttcacccacttataaacacttattcaggccatctc 50858999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 21041436 - 21041322
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | ||||||| |||||||| |||  | ||||| ||| ||||||||||||| ||  ||||||||||||||||||  |  ||||||||  | ||    
21041436 tcttagaatttgtggttgtgcctaacataacttcgcaaaaccggtttgtgaggtgaggattttccccacttataaacacatgttttggccatcttttgtc 21041337  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
21041336 cgatgtgggactctt 21041322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 21646500 - 21646586
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| |||||||||||||| | | ||||| |||| || ||||| |||||||| ||| ||| |||| |||||||||||||||    
21646500 tcttaaaaatcgtggttgggcctaatagagccccataaaaccgacttgtaaggtgaggattgtccctacttgtaaacacattgtcag 21646586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 50828207 - 50828285
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| | ||| |||||||||||||| |||||||||| |||| |||||||||| |  | | |||||||||||||||    
50828207 tcttagaatttgtgtttgggcctaacacagccccacaaaaccggcctgtgaggtgatgactactcccacttataaacac 50828285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 134 - 251
Target Start/End: Original strand, 41037019 - 41037136
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||| |||||||| || |||| || ||||| || | || |||||||||||||||||||| | ||| ||||  ||||||||||| |||||| | ||||  |    
41037019 gatttttagaaatcgtagttgagcttaacataatctcataaaatcggcttgtgaggtgaagattgtccccgtttataaacacactgtcagactatctttt 41037118  T
234 atccgatgtgtgactctt 251  Q
    |||||||||  |||||||    
41037119 atccgatgtaagactctt 41037136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 22867187 - 22867147
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    ||||||||||||||||||||||| |||||||| ||||||||    
22867187 gggcctaacacaaccccacaaaaccggcttgtaaggtgagg 22867147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 149 - 217
Target Start/End: Original strand, 30529937 - 30530005
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||| ||||||||||| | || |||| ||||||||||||||||  || |||| ||||||||||||||    
30529937 tggttgagcctaacacaatctcataaaaccggcttgtgaggtgagaattaccccaacttataaacacat 30530005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 161 - 201
Target Start/End: Original strand, 52146088 - 52146128
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgccc 201  Q
    |||||||||||||||| ||||||||||||||||| ||||||    
52146088 acacaaccccacaaaaccggcttgtgaggtgaggattgccc 52146128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 164 - 231
Target Start/End: Original strand, 7572728 - 7572795
Alignment:
164 caaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||||||||||   |||||||||||||| | || ||||||||||||||||| |  ||||||||||||    
7572728 caaccccacaaagctggcttgtgaggtgaagattacccccacttataaacacttgttcaggccatctc 7572795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 165 - 228
Target Start/End: Complemental strand, 7892605 - 7892542
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||||||| ||| ||||||| |||   ||||| |||||||||||||||||||||| ||||    
7892605 aaccccacaaaaccggattgtgagatgaaaattgcctccacttataaacacattgtcagaccat 7892542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 24513140 - 24513211
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttata 210  Q
    ||||||||  |||||| ||||||||||| |||||||||  ||||| |||||||||| ||||||  |||||||    
24513140 ttagaaatcatggttgcgcctaacacaatcccacaaaactggcttctgaggtgaggattgcccatacttata 24513211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 192
Target Start/End: Complemental strand, 28501673 - 28501618
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||||| ||| |||||| |||||||||| ||| ||||||| |||||||||||||||    
28501673 tcttaggaattgtggttaggcctaacacgacctcacaaaaccggcttgtgaggtga 28501618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 40716632 - 40716683
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcc 200  Q
    |||||||||||||||||||||||||||  |||||||| |||| ||| |||||    
40716632 tggttgggcctaacacaaccccacaaatccggcttgtaaggtaaggattgcc 40716683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 41743136 - 41743191
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    ||||||||||||||||| ||||| |||||| ||||||||||| |||| ||| ||||    
41743136 ttagaaatggtggttggacctaatacaacctcacaaaatcggtttgtaaggcgagg 41743191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 6778511 - 6778561
Alignment:
206 ttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| | |||||||| |||| |||||||||||||| ||||||||||||    
6778511 ttataaatatattgtcagaccatgtcctatccgatgtgggactcttaacac 6778561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 151 - 217
Target Start/End: Original strand, 11056345 - 11056411
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||| ||||||||||||| |||||  | |||||||| || | |||| |||||||||||||||||    
11056345 gttgggcttaacacaaccccataaaattagtttgtgaggcgaagattgctcccacttataaacacat 11056411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 214
Target Start/End: Complemental strand, 32002642 - 32002565
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||| |||| ||| ||||||  |||||||||  || ||||||| ||||||||||| || ||||||||||||||||||    
32002642 ttcttaaaaatcgtgtttgggctaaacacaaccttactaaatcggtttgtgaggtga-ggatgcccccacttataaaca 32002565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 180 - 250
Target Start/End: Complemental strand, 40965111 - 40965041
Alignment:
180 gcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    ||||||||||||| | |||| |||||||||| || |||| ||||| |||||| ||||| ||||| ||||||    
40965111 gcttgtgaggtgatgattgcacccacttatatacgcattatcaggtcatctcttatccaatgtgagactct 40965041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 161 - 215
Target Start/End: Original strand, 48052815 - 48052869
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||||||||||| | |||||||||||||||  ||| ||||||| |||||||    
48052815 acacaaccccacaaaaccagcttgtgaggtgaggactgctcccacttgtaaacac 48052869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 4455563 - 4455600
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgag 193  Q
    ||||||||||||||||||||||| |||||| |||||||    
4455563 gcctaacacaaccccacaaaatcagcttgttaggtgag 4455600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 23210142 - 23210069
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttata 210  Q
    |||||||||| ||||||  | |||||| |||  ||||||| ||||||||||||||||  || ||||||||||||    
23210142 tcttagaaatcgtggttatgtctaacataacatcacaaaaccggcttgtgaggtgagaattacccccacttata 23210069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 32333956 - 32334021
Alignment:
184 gtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    |||| |||||| ||| ||||||||||||||||||  ||||| |||||| ||||| ||||| |||||    
32333956 gtgaagtgaggattgtccccacttataaacacatgttcaggtcatctcttatccaatgtgcgactc 32334021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 20726631 - 20726679
Alignment:
166 accccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||||  |||||||| ||||| | |||||||||||||||||||    
20726631 accccacaaaactggcttgtgtggtgatgattgcccccacttataaaca 20726679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 31039346 - 31039397
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgagg 189  Q
    |||||||||| |||||||| ||||||||||| |||||||| || |||||||||    
31039346 tcttagaaattgtggttgg-cctaacacaactccacaaaaccgacttgtgagg 31039397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 43743074 - 43742998
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    ||||| |||| |||||| || |||||| ||||||| ||||  |||||||||| ||||| || | |||||||||||||    
43743074 tcttataaatcgtggttaggtctaacataaccccaaaaaactggcttgtgagttgaggattactcccacttataaac 43742998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 2237 - 2117
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| |    
2237 ttcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgt 2138  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
2137 ccgatgtgggactcttaacac 2117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 2001 - 1883
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||| |||| |||| ||    
2001 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 1902  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
1901 cgatgtgggactcttaaca 1883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 97; Significance: 2e-47; HSPs: 98)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 4868575 - 4868695
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |    
4868575 ttcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgt 4868674  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
4868675 ccgatgtgggactcttaacac 4868695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 13353286 - 13353168
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||    
13353286 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 13353187  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
13353186 cgatgtgggactcttaaca 13353168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 33494624 - 33494506
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||| ||| |||||||||||||    
33494624 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatc 33494525  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
33494524 cgatgtgggactcttaaca 33494506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 33796411 - 33796293
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||    
33796411 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 33796312  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
33796311 cgatgtgggactcttaaca 33796293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 4868812 - 4868930
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||| |||| ||    
4868812 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccatgtcctgtc 4868911  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
4868912 cgatgtgggactcttaaca 4868930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 9705105 - 9704987
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||||| || |||||||    
9705105 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacacattgtcaggctatgtcctatc 9705006  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
9705005 cgatgtgagactcttaaca 9704987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 9705339 - 9705220
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| | ||||| |||||||    
9705339 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctatc 9705240  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
9705239 cgatgtgggactcttaacac 9705220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 17147659 - 17147778
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| ||| |||||||    
17147659 tcttagaaatggtggttggacctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctatc 17147758  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
17147759 cgatgtgggactcttaacac 17147778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 139 - 258
Target Start/End: Complemental strand, 21690805 - 21690686
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||  ||||| |||    
21690805 ttagaaatcgtggttgagcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaaatcctaaccg 21690706  T
239 atgtgtgactcttaacaccg 258  Q
    ||||| ||||||||||||||    
21690705 atgtgggactcttaacaccg 21690686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 139 - 257
Target Start/End: Complemental strand, 27656541 - 27656423
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||| |||||||||||| |||||| |||    
27656541 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccg 27656442  T
239 atgtgtgactcttaacacc 257  Q
    ||||| |||||||||||||    
27656441 atgtgggactcttaacacc 27656423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 19713038 - 19712918
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||  ||||||||||||||||||| |||||||||||| ||||||     
19713038 ttcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaa 19712939  T
236 ccgatgtgtgactcttaacac 256  Q
    ||||||||  |||||||||||    
19712938 ccgatgtggaactcttaacac 19712918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 139 - 257
Target Start/End: Complemental strand, 8026472 - 8026354
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| ||| || |||    
8026472 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcataaccg 8026373  T
239 atgtgtgactcttaacacc 257  Q
    | ||| |||||||||||||    
8026372 acgtgggactcttaacacc 8026354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 135 - 253
Target Start/End: Original strand, 25065091 - 25065209
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||| |||||||| |||| |||||    
25065091 attcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaacatattgtcagaccatgtccta 25065190  T
235 tccgatgtgtgactcttaa 253  Q
    ||||||||| |||||||||    
25065191 tccgatgtgggactcttaa 25065209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 139 - 240
Target Start/End: Original strand, 12330180 - 12330281
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
12330180 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgaggtgagggttgcccccacttataaacacattgtcagaccatgtcctatccg 12330279  T
239 at 240  Q
    ||    
12330280 at 12330281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 139 - 253
Target Start/End: Complemental strand, 30256895 - 30256782
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| ||||||||| |||| ||||||||    
30256895 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacatattgtcaggtcatcacctatccg 30256797  T
239 atgtgtgactcttaa 253  Q
    ||||| |||||||||    
30256796 atgtgggactcttaa 30256782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 12330292 - 12330407
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||| ||||||| ||||||||||| ||||| ||| |||||||||||||||||||||||| |||| |||||||||    
12330292 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgagatgaggattg-ccccacttataaacacattgtcagaccatgtcctatccg 12330390  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
12330391 atgtgggactcttaaca 12330407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 27653300 - 27653184
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||| ||||||||| || |||||||||||||| || |||||||||||||||| |||||||||||| |||||| |||    
27653300 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccg 27653201  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
27653200 atgtgggactcttaaca 27653184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 27772797 - 27772681
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||| ||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
27772797 ttagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 27772698  T
239 atgtgtgactcttaaca 255  Q
    ||||| || ||||||||    
27772697 atgtgggaatcttaaca 27772681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 6054488 - 6054369
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||||||||| |||||||||| ||||||||||||| ||||||||||||||||| || ||||||| ||||||| ||||    
6054488 tcttagaaatcgtggttgggtctaacacaaccctacaaaatcggtttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctcttatc 6054389  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  ||||||||||||    
6054388 cgatgttggactcttaacac 6054369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 6542942 - 6543060
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||| ||||| ||||||||| ||||||||||||||||||| |||||| |||||||| | |||||||||||||||||||||||||||| ||||||| ||||    
6542942 tctttgaaatcgtggttgggtctaacacaaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatc 6543041  T
237 cgatgtgtgactcttaaca 255  Q
    |||||||  ||||||||||    
6543042 cgatgtggaactcttaaca 6543060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 27773029 - 27772912
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||||||| |||||||| ||||||||| | ||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
27773029 ttagaaattatggttgggcttaacacaatcccacaaaaccagcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 27772930  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
27772929 atgtgggactcttaacac 27772912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 8566960 - 8567075
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||| |||  ||||||||||||||||||||||| ||||| ||||||||    
8566960 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattg-tcccacttataaacacattgtcagaccatcacctatccg 8567058  T
239 atgtgtgactcttaaca 255  Q
    | ||| |||||||||||    
8567059 aggtgggactcttaaca 8567075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 142 - 249
Target Start/End: Original strand, 16722811 - 16722918
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||  |||| |||||||||||||| ||| |||||||||| | |||||||||    
16722811 gaaatagtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattgctcccacttataaacagattatcaggccatcacatatccgatg 16722910  T
242 tgtgactc 249  Q
    || |||||    
16722911 tgggactc 16722918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 3680097 - 3679979
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||  |||| ||||||||| |||||||||||||||||| | ||| | ||||    
3680097 tcttagaaattgtggttgggcctaacacaaccccacaaaatcgacttgtgagaggaggattgcccccagttataaacacattgtcagactatcacttatc 3679998  T
237 cgatgtgtgactcttaaca 255  Q
    ||| ||| |||||||||||    
3679997 cgacgtgagactcttaaca 3679979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 2736164 - 2736285
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||| ||||||||| || |||||||| | || |||||||||| ||| ||||||||||||||||||||||||| |||||||||    
2736164 attcttagaaatcgtggttgggtctaacacaatcctacaaaatctgtttatgaggtgaggattgtccccacttataaacacattgtcaggtcatctccta 2736263  T
235 tccgatgtgtgactcttaacac 256  Q
     |||||||| |||||| |||||    
2736264 cccgatgtgggactctcaacac 2736285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 148 - 257
Target Start/End: Original strand, 6400630 - 6400739
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||||| ||||||||||||||||||| || ||||||| |||||| ||||| ||||||||||||||||||||||||||| || | ||||||||| |||    
6400630 gtggttgggtctaacacaaccccacaaaaccgacttgtgatgtgaggattgcctccacttataaacacattgtcaggccatgtcatgtccgatgtgagac 6400729  T
248 tcttaacacc 257  Q
    ||||||||||    
6400730 tcttaacacc 6400739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 143 - 256
Target Start/End: Original strand, 12329949 - 12330062
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||| |   ||| || ||||||||||    
12329949 aaatcgtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaacacattgttatatcatatcttatccgatgt 12330048  T
243 gtgactcttaacac 256  Q
    | ||||||||||||    
12330049 gggactcttaacac 12330062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 140 - 256
Target Start/End: Original strand, 5572386 - 5572502
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| ||||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||||||||| |||||||||| | |||||| ||||    
5572386 tagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggatggccccaacttataaacaaattgtcaggcaaactcctaaccga 5572485  T
240 tgtgtgactcttaacac 256  Q
    |||| |||| |||||||    
5572486 tgtgagacttttaacac 5572502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 7915934 - 7915817
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| ||||||||| ||||||  ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| || ||||    
7915934 tcttagaaatcgtggttgggtctaaca--accccacaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccaacttctat 7915837  T
236 ccgatgtgtgactcttaaca 255  Q
    || ||||  |||||||||||    
7915836 ccaatgttggactcttaaca 7915817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 13741001 - 13740885
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| || ||||||| |||||| |||| |||||||||||||| |||||||||||| | | ||||    
13741001 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatc 13740902  T
237 cgatgtgtgactcttaa 253  Q
    |||||||  ||||||||    
13740901 cgatgtggaactcttaa 13740885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 13746501 - 13746385
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| || ||||||| |||||| |||| |||||||||||||| |||||||||||| | | ||||    
13746501 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatc 13746402  T
237 cgatgtgtgactcttaa 253  Q
    |||||||  ||||||||    
13746401 cgatgtggaactcttaa 13746385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 24554200 - 24554084
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  |||||| | |||||||||| |||||||| ||||||||||||||| | ||||||||||||||||| | |||||||| ||||||||||||||    
24554200 ttagaaattatggttgagactaacacaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctcctatccg 24554101  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
24554100 atgtgggactcttaaca 24554084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 11721990 - 11721875
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||| ||||| || ||| |||||| |    
11721990 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaac 11721891  T
237 cgatgtgtgactctta 252  Q
     ||| || ||||||||    
11721890 tgatatgagactctta 11721875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 19639112 - 19639231
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| ||||||||| |||||| ||| ||| ||||||||||||| ||| ||||||||||||||||||||||||||||| || ||||    
19639112 tcttagaaatcgtggttggacctaacacagccccactaaaccggtttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcttatc 19639211  T
237 cgatgtgtgactcttaacac 256  Q
    | ||||| || |||||||||    
19639212 ctatgtgggattcttaacac 19639231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 149 - 255
Target Start/End: Complemental strand, 2753331 - 2753225
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||||||||||||||||||||||| || |||||||||||||| || |||||||||||||||||||||||||  ||||  || ||||||||| ||||    
2753331 tggttgggcctaacacaaccccacaaaaccgccttgtgaggtgaggattacccccacttataaacacattgtcagatcatcatctttccgatgtgggact 2753232  T
249 cttaaca 255  Q
    |||||||    
2753231 cttaaca 2753225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 11085666 - 11085548
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| |||| |||||||||||| ||||||| |||||||||| |||||  ||||||||||||||||||| |||||| |||||||||||| |    
11085666 tcttagaaatcgtgattggacctaacacaaccgcacaaaaccggcttgtgaagtgagaattgcccccacttataaacatattgtcgggccatctcctacc 11085567  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||| ||||||    
11085566 cgatgtgagactattaaca 11085548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 153 - 255
Target Start/End: Original strand, 28867972 - 28868074
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctta 252  Q
    |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| | ||||||||| || ||| || |||||||| ||||||||    
28867972 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactctta 28868071  T
253 aca 255  Q
    |||    
28868072 aca 28868074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 138 - 256
Target Start/End: Complemental strand, 30256662 - 30256544
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||| ||||||||||||||||||||||||||||| ||| ||||||| ||||| ||||||||| |||||||||||||||||  |||| |  | |||    
30256662 cttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtcaaaccatgtattgtcc 30256563  T
238 gatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||    
30256562 gatgtgagactcttaacac 30256544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 15081909 - 15082026
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||| ||||||||||||||| ||||||||| ||||||||||| | ||| |||||||||||| |||||| |||||||| |||||||||| |||    
15081909 ttagaaatcgtgtttgggcctaacacaatcccacaaaaccggcttgtgagttaaggattgcccccacttgtaaacatattgtcagtccatctcctaaccg 15082008  T
239 atgtgtgactcttaacac 256  Q
     |||| ||||||||||||    
15082009 ttgtgggactcttaacac 15082026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 6542708 - 6542826
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| | ||||||||||| |||||| ||| ||||||||||| | ||||||| | ||||||||| |||||||| ||||||||||||    
6542708 tcttagaaatcgtggttggacttaacacaaccctacaaaaccggtttgtgaggtgatgattgcccc-atttataaacagattgtcagaccatctcctatc 6542806  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
6542807 cgatgtgagactcttaacac 6542826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 19712801 - 19712722
Alignment:
137 tcttagaaatggtggttgggcctaacaca--accccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||| |||||||||||||||||||    
19712801 tcttagaaatggtggttgggcctaacacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 3713427 - 3713322
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||  ||||||||||||| ||| |||||| ||||| | ||||||||||||||||||||| |||| ||||||    
3713427 tcttagaaattgtggttgtgcctaacacaaccttacaaaatcggcttttgatgtgaggattgcctcaacttataaacacattgtcaggtcatcacctatc 3713328  T
237 cgatgt 242  Q
     |||||    
3713327 tgatgt 3713322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 5572617 - 5572733
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||| |||| |||||||||||  ||||||||||||||||| | ||||||||||||||||| ||||||| |||| ||||||  ||    
5572617 ttagaaatcgtggttgggccgaacaaaaccccacaaac-cggcttgtgaggtgaggatggcccccacttataaacaaattgtcatgccaactcctaaacg 5572715  T
239 atgtgtgactcttaacac 256  Q
    ||||| || |||||||||    
5572716 atgtgggattcttaacac 5572733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 166 - 255
Target Start/End: Original strand, 6400874 - 6400963
Alignment:
166 accccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||| ||||||||||||||||| ||||| ||||||||||||| ||||||||||||| || | ||||||||| |||||||||||    
6400874 accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaaca 6400963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 2736403 - 2736519
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||| ||| |||||||| || |||||| || ||||||| |||||  ||||||||||||||||||||||| ||||| |||||| ||||||    
2736403 ttagaaatcgtggttaggcttaacacaatccaacaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccg 2736502  T
239 atgtgtgactcttaaca 255  Q
    |||||  ||||||||||    
2736503 atgtggaactcttaaca 2736519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 12199803 - 12199919
Alignment:
137 tcttagaaatggtggtt-gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| |||||| ||||||||||||||  |||||||  | |||||||||||| | ||||||||||||||||||| |||||||| |||| || |||    
12199803 tcttagaaatcgtggtttgggcctaacacaacatcacaaaacggacttgtgaggtgatgattgcccccacttataaacatattgtcagaccatatcttat 12199902  T
236 ccgatgtgtgactctta 252  Q
    |||||||| ||||||||    
12199903 ccgatgtgggactctta 12199919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 236
Target Start/End: Complemental strand, 16570244 - 16570145
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| || ||||| | |||||| || ||||| |||||||||||||||||||| |||||| ||||    
16570244 tcttagaaatcatggttgggcctaacacaaccccacaaaaccgacttgttacgtgaggattacccccgcttataaacacattgtcaggacatctcttatc 16570145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 8001549 - 8001626
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||| |||||||||||||||||||||| ||||||||| ||| |||||||| | |||||||||||||||||||    
8001549 tcttagaaattgtggttgggcctaacacaacccaacaaaatcgacttatgaggtgaagattgcccccacttataaaca 8001626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 8026687 - 8026622
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccca 204  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||    
8026687 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 8026622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 181 - 257
Target Start/End: Complemental strand, 3680287 - 3680211
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacacc 257  Q
    |||||||||||| | |||||||||||||||||||||||||||| ||||| | ||||||||||| |||||||||||||    
3680287 cttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacatatccgatgtgggactcttaacacc 3680211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 155 - 255
Target Start/End: Complemental strand, 21215052 - 21214952
Alignment:
155 ggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    |||||||||||||||||||||| || ||| |||||||| | ||||||  ||||||||||||||||| || ||||| ||||| ||| ||||||||||||||    
21215052 ggcctaacacaaccccacaaaaccgacttttgaggtgatgattgcccaaacttataaacacattgtgagaccatcacctattcgacgtgtgactcttaac 21214953  T
255 a 255  Q
    |    
21214952 a 21214952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 148 - 255
Target Start/End: Original strand, 2737180 - 2737287
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    |||||| ||| |||||||| || |||||| || ||||||| |||||  ||||||||||||||||||||||| ||||| |||||| |||||||||||  ||    
2737180 gtggttaggcttaacacaatccaacaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaac 2737279  T
248 tcttaaca 255  Q
    ||||||||    
2737280 tcttaaca 2737287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 207
Target Start/End: Original strand, 6623409 - 6623479
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||| ||||||||||||    
6623409 tcttagaaatcgtggttggacctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccactt 6623479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 161 - 255
Target Start/End: Complemental strand, 15600997 - 15600903
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||  | ||||||| |||||| ||||||||||||||||||| ||| |||| ||| |||||| |||||||| |||||||||||    
15600997 acacaaccccacaaaactgacttgtgaagtgaggattgcccccacttataaacaaattatcagaccaactcctaaccgatgtgggactcttaaca 15600903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 31961218 - 31961144
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||| ||| |||||||||||||||||||||||||||||||||| | |||| |||||| ||||||||||||    
31961218 ttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacatatctgatgtgggactcttaacac 31961144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 159 - 256
Target Start/End: Complemental strand, 33494838 - 33494740
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgc-ccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| |||| |||||||||||||||||  |   ||||||||||||| | |||||||| ||||||||||||||||||| ||||||||||||    
33494838 taacacaaccccataaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaacac 33494740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 6066062 - 6065941
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||  ||| ||||||||||||||||||||||||||||| |  ||||| |||||||| |||||||  ||||||||||||||||||| ||||| | ||    
6066062 attcttaagaattgtggttgggcctaacacaaccccacaaaaccaacttgtcaggtgaggattgcccc--cttataaacacattgtcagaccatcacata 6065965  T
235 tccg--atgtgtgactcttaacac 256  Q
    || |  ||||| ||||||||||||    
6065964 tctgatatgtgggactcttaacac 6065941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 149 - 241
Target Start/End: Original strand, 33631816 - 33631907
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    ||||||| |||||| ||||||||||||| ||| || |||||||||| |||  |||||||||||||||||||||||| |||| |||||||||||    
33631816 tggttggacctaactcaaccccacaaaaccgg-ttatgaggtgaggattgttcccacttataaacacattgtcaggtcatcacctatccgatg 33631907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 5648671 - 5648790
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||| |||||||||||| ||||||| ||||||||||||||| | ||| ||  | |||||||||||||| || | ||||||||||     
5648671 tcttagaaattatggttggacctaacacaacctcacaaaaccggcttgtgaggtgatgattgtccttaattataaacacattggcaagtcatctcctatt 5648770  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  || |||||||||    
5648771 cgatgtaggaatcttaacac 5648790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 10145749 - 10145868
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||| ||||||  | ||||||||||||   ||| ||| | ||||||||||||| ||||| ||||||| |||    
10145749 tcttagaaattgtggttgagcctaacacaaccctacaaaactgacttgtgaggtgaaaattgtccctatttataaacacattatcaggtcatctcccatc 10145848  T
237 cgatgtgtgactcttaacac 256  Q
    | ||||| || |||||||||    
10145849 caatgtgagattcttaacac 10145868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 30505789 - 30505702
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccactt-ataaacacattgtcaggccatctcctatccgatgtgtgactcttaacacc 257  Q
    ||||||||||||| |||||||||| ||| |||||||| | |||||||||||||| ||||||  ||||||||||| |||||||||||||    
30505789 acaaaatcggcttatgaggtgaggattgtccccactttacaaacacattgtcagaccatcttatatccgatgtgggactcttaacacc 30505702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 157 - 251
Target Start/End: Complemental strand, 3823369 - 3823275
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||||| |||||| | |||||| |||| | ||| ||||||||||||||| ||| ||||| |||||| ||||||||||| |||||||    
3823369 cctaacacaaccccataaaatcagtttgtgatgtgatgattgtccccacttataaacaaattatcaggtcatctcttatccgatgtgagactctt 3823275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 182 - 256
Target Start/End: Original strand, 7638634 - 7638708
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||| || ||| ||||||||||||    
7638634 ttgtaaggtgaggattgcccccacttataaacacattatcaggtcatctcctatctgacgtgagactcttaacac 7638708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 11085898 - 11085780
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || |||||| |||||| |||  ||||||||| |  |||||||||||  |||| |||||||||||| | |||| |||| |||||||||||    
11085898 tcttagaaatcgtcgttgggtctaacataacttcacaaaatctgtgtgtgaggtgagcattgctcccacttataaatatattggcaggtcatctcctatc 11085799  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||| ||||||    
11085798 cgatgtgagacttttaaca 11085780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 158 - 255
Target Start/End: Complemental strand, 4906870 - 4906773
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||| |||| ||||  |||||||||| ||||| |||||| ||||||||||||||||||| | | ||||| |||||||||||  ||||||||||    
4906870 ctaacacaatcccataaaactggcttgtgagatgaggattgccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaaca 4906773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 178 - 255
Target Start/End: Original strand, 6237742 - 6237819
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||| |||||| |||||||||| ||||||||||||| || | ||||| ||||| |||||||||||    
6237742 cggcttgtgaggtgaggattgccctcacttataaatacattgtcaggccttcacttatccaatgtgggactcttaaca 6237819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 139 - 228
Target Start/End: Complemental strand, 13740764 - 13740675
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||| ||||||| ||||||||||||| ||||||| || ||| ||||| |||| ||| | |||||||||||||||||||||| ||||    
13740764 ttagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccat 13740675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 139 - 228
Target Start/End: Complemental strand, 13746264 - 13746175
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||| ||||||| ||||||||||||| ||||||| || ||| ||||| |||| ||| | |||||||||||||||||||||| ||||    
13746264 ttagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccat 13746175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 12885140 - 12885021
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-act--tataaacacattgtcaggccatctcctat 235  Q
    |||||||| |||||| | |||||||||||||||||||||| ||| || |||||| | |||||||| |||  |||||||||||||||||| |||||| ||     
12885140 ttagaaatcgtggttagacctaacacaaccccacaaaatcagctcgtaaggtgatgattgccccctacttatataaacacattgtcaggtcatctcttaa 12885041  T
236 ccgatgtgtgactcttaaca 255  Q
    | |||||| |||| ||||||    
12885040 ctgatgtgagacttttaaca 12885021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 20373655 - 20373584
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttat 209  Q
    ||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||  |||||||    
20373655 tcttataaatcgtggttgggcctaacacaaccccacaaaat-ggcttgtgaggtgaggattgccatcacttat 20373584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 139 - 254
Target Start/End: Original strand, 15082145 - 15082259
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||||  ||   ||||||||||||||||||||   |||||| ||| ||     
15082145 ttagaaatcgtgtttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggactg-ttccacttataaacacattgtctaaccatctgctaacca 15082243  T
239 atgtgtgactcttaac 254  Q
    |||||  |||||||||    
15082244 atgtggaactcttaac 15082259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 24554434 - 24554316
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||| | | || | |||| ||||||||||||| |||| |||||||| ||||||| ||| ||||| ||||||| |  ||||||| ||||    
24554434 tcttagaaatcgtggtggagtctgagacaatcccacaaaatcggtttgtaaggtgaggattgcccc-actaataaatacattgttaaaccatctcatatc 24554336  T
237 cgatgtgtgactcttaacac 256  Q
     |||||||||||||||||||    
24554335 tgatgtgtgactcttaacac 24554316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 30849401 - 30849516
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||  || || ||| ||||||||||||||| ||||||| || |||||| |||| ||||||||||| ||||||| ||   |||||| ||||    
30849401 tcttagaaatcgtaattaggtctagcacaaccccacaaaaccggcttgcgatgtgaggattgctcccacttataagcacattgccatatcatctcatatc 30849500  T
237 cgatgtgtgactctta 252  Q
    ||||||| ||||||||    
30849501 cgatgtgagactctta 30849516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 171 - 248
Target Start/End: Original strand, 15102964 - 15103041
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||| |||| ||||| |||||  |||||||| |||||||||||||||||||| |||| ||||||||||||| ||||    
15102964 acaaaaccggcctgtgaagtgagaattgcccccgcttataaacacattgtcaggtcatcacctatccgatgtgagact 15103041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 205 - 256
Target Start/End: Complemental strand, 13353453 - 13353402
Alignment:
205 cttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||||||||||||| |||| ||||||||| ||||||||||||    
13353453 cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacac 13353402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 205 - 256
Target Start/End: Complemental strand, 33796578 - 33796527
Alignment:
205 cttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||||||||||||| |||| ||||||||| ||||||||||||    
33796578 cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacac 33796527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 149 - 215
Target Start/End: Original strand, 7333093 - 7333159
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||||||||||||| ||||||  ||||||||||||||||   ||| ||||||||||||||    
7333093 tggttgggcctaacacaaccctacaaaactggcttgtgaggtgaggaccgcctccacttataaacac 7333159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 12319709 - 12319787
Alignment:
173 aaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||| || ||| |||| |||||||||||||||||||||||||||||||| | |||||| ||||  ||||| |||||||    
12319709 aaaataggtttgggaggcgagggttgcccccacttataaacacattgtcatgtcatctcttatctaatgtgagactctt 12319787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 231
Target Start/End: Complemental strand, 32290813 - 32290719
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||||||||| || ||| ||||||||||||||| ||||||| | |||| |||||| |  || | |||||||||||||||||| ||||| ||||||    
32290813 tcttagaaatcgttgtttggcctaacacaaccctacaaaattgacttgcgaggtgggaattactcccacttataaacacattatcaggtcatctc 32290719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 4161845 - 4161926
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacat 217  Q
    |||||||||| |||||||||||||||||||||||||||||  || ||||| ||||| | || ||||| ||||| ||||||||    
4161845 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtgtggtgaagattccccccgacttagaaacacat 4161926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 4223465 - 4223546
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacat 217  Q
    |||||||||| |||||||||||||||||||||||||||||  || ||||| ||||| | || ||||| ||||| ||||||||    
4223465 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtgtggtgaagattccccccgacttagaaacacat 4223546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 214 - 255
Target Start/End: Complemental strand, 30505511 - 30505470
Alignment:
214 acattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||||||||||||||| |||||||||||    
30505511 acattgtcaggccatctcctatccgatgtgagactcttaaca 30505470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 187 - 255
Target Start/End: Complemental strand, 6369499 - 6369431
Alignment:
187 aggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||| ||||||||||||||||||||||||| ||  |||| ||| ||| ||||| |||||||||||    
6369499 aggtgaggattgcccccacttataaacacattgttagatcatcacctgtccaatgtgggactcttaaca 6369431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 141 - 256
Target Start/End: Complemental strand, 32291043 - 32290929
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| |||||||||||||||| || ||||||||| || | || ||| ||||| ||| ||||| |||||||||||||| |||   |||| ||||| |||    
32291043 agaaatcgtggttgggcctaacataagcccacaaaaccgacctgcgagatgaggattg-ccccatttataaacacattgccagataatcttctatctgat 32290945  T
241 gtgtgactcttaacac 256  Q
    ||| |||| |||||||    
32290944 gtgggacttttaacac 32290929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 6054254 - 6054136
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| | ||||||| | |||||||||  | ||| |||||||| | ||| || |||||||||||| |||||||| |||| || ||      
6054254 tcttagaaatcgtggttgagtctaacacgatcccacaaaactgacttatgaggtgatgattgtcctcacttataaacagattgtcagaccatatcttaaa 6054155  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||  |||||||||||    
6054154 cgatgtaggactcttaaca 6054136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 181 - 255
Target Start/End: Original strand, 12199728 - 12199802
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||| || |||||||||||||| ||||||||||| ||| | ||||| ||| || ||| |||||||    
12199728 cttgtgaggtgaggattacccccacttataaatacattgtcaggtcatgttctatctgatatgggacgcttaaca 12199802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 20830814 - 20830760
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaa 212  Q
    ||||||||||| ||||||||| | ||||||||||| | |||||||||||||||||    
20830814 ctaacacaacctcacaaaatcagtttgtgaggtgatgattgcccccacttataaa 20830760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 254
Target Start/End: Original strand, 1788948 - 1789064
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||| ||  ||||| |||||| |||||||     ||||||||||| | || |||| ||||||| |||||||||||  |||| | |||||    
1788948 tcttagaaatggtggctgaacctaatacaacctcacaaaacaaaattgtgaggtgaagattacccctacttatagacacattgtcaaaccattttctatc 1789047  T
237 cgatgtgtgactcttaac 254  Q
    ||||||| ||||||||||    
1789048 cgatgtg-gactcttaac 1789064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 136 - 220
Target Start/End: Original strand, 7638846 - 7638930
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt 220  Q
    |||||||||||  | ||||| |||||||||||| ||||||| | ||||||||||||| | ||| || || ||||||||| |||||    
7638846 ttcttagaaatcatagttggacctaacacaaccgcacaaaaccagcttgtgaggtgaagattgtcctcatttataaacatattgt 7638930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 20661114 - 20661060
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||| ||||||| || |||| ||||||||||||| |||||||||||||||    
20661114 taacacaacctcacaaaaccgacttgagaggtgagggttg-ccccacttataaaca 20661060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 1788778 - 1788824
Alignment:
179 ggcttgtgaggtgagggttgcccccacttataaacacattgtcaggc 225  Q
    |||||||||||||||  ||| ||||||||||||| ||||||||||||    
1788778 ggcttgtgaggtgagtattgtccccacttataaatacattgtcaggc 1788824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 170 - 252
Target Start/End: Original strand, 10145547 - 10145629
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctta 252  Q
    ||||||| ||||||||||||| ||| ||||  ||| |||||||||||| || ||| |||||  |||| |||||| ||||||||    
10145547 cacaaaaccggcttgtgaggttaggattgcttccatttataaacacatcgttaggacatcttatatcagatgtgggactctta 10145629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 1788715 - 1788760
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||||||| ||||| | |||||||||||||||||||| |||||||    
1788715 cggcttgtgtggtgaagattgcccccacttataaacactttgtcag 1788760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 151 - 248
Target Start/End: Complemental strand, 3823705 - 3823608
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||| |||||||||||  |||||||||  |  ||||| ||||||  |||| ||||||||||||| ||||||| || ||||| ||| ||||||| ||||    
3823705 gttgtgcctaacacaattccacaaaataagtctgtgatgtgaggactgcctccacttataaacatattgtcacgctatctcttattcgatgtgagact 3823608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 210 - 255
Target Start/End: Complemental strand, 19648351 - 19648306
Alignment:
210 aaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||| ||||||| ||||||||||| |||| ||||||    
19648351 aaacacattgtcagaccatctcatatccgatgtgggacttttaaca 19648306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 172 - 224
Target Start/End: Complemental strand, 467661 - 467609
Alignment:
172 caaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg 224  Q
    ||||| |||||| ||||||||||  | ||||||||| ||||||||||||||||    
467661 caaaaccggcttatgaggtgaggacttcccccacttgtaaacacattgtcagg 467609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 12319913 - 12319961
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||||||||||| |  ||||||| ||||||||||||| |||||    
12319913 taacacaaccccacaaaaccaacttgtgaagtgagggttgcccacactt 12319961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 33631638 - 33631690
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||||| ||| || |  ||||||| ||||||||||||||||||||||    
33631638 aaccccacaaaaccggtttatatggtgaggattgcccccacttataaacacat 33631690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 96; Significance: 9e-47; HSPs: 136)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 11232193 - 11232312
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||    
11232193 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 11232292  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
11232293 cgatgtgggactcttaacac 11232312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 24532420 - 24532538
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||    
24532420 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctcctatc 24532519  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
24532520 cgatgtgggactcttaaca 24532538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 39052928 - 39053046
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||    
39052928 tcttagaaatcgttgttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 39053027  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
39053028 cgatgtgggactcttaaca 39053046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 11232428 - 11232546
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||| |||| |||| ||    
11232428 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 11232527  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
11232528 cgatgtgggactcttaaca 11232546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 5931946 - 5932067
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||    
5931946 attcttaaaaatggtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtacta 5932045  T
235 tccgatgtgtgactcttaacac 256  Q
    || |||||| ||||||||||||    
5932046 tctgatgtgggactcttaacac 5932067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 19256587 - 19256704
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
19256587 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 19256686  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
19256687 atgtgggactcttaacac 19256704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 136 - 257
Target Start/End: Original strand, 35682779 - 35682900
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||| |    
35682779 ttcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgt 35682878  T
236 ccgatgtgtgactcttaacacc 257  Q
    ||||||||  ||||||||||||    
35682879 ccgatgtggaactcttaacacc 35682900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 39743612 - 39743495
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||| |||||| |||    
39743612 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccccaacttataaacaaattgtcaggccaactcctaaccg 39743513  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
39743512 atgtgggactcttaacac 39743495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 39960277 - 39960156
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||| ||| ||||||||||||||||    
39960277 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctat 39960178  T
236 ccgatgtgtgactcttaacacc 257  Q
    |||||||| |||||||||||||    
39960177 ccgatgtgggactcttaacacc 39960156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 17477148 - 17477031
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
17477148 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 17477049  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
17477048 atgtgggactcttaacac 17477031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 15042668 - 15042788
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||||||||||||||||||||| || |||    
15042668 ttcttagaaatcgtggttgagcctaacacaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaacacattgtcaggccatgtcgtat 15042767  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
15042768 ccgatgtgggactcttaacac 15042788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 17469901 - 17469785
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
17469901 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 17469802  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
17469801 atgtgggactcttaaca 17469785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 19256821 - 19256937
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
19256821 ttagaaatcgtggttgggcctaacacaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 19256920  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
19256921 atgtgggactcttaaca 19256937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 24075307 - 24075423
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||||||||| |||||| |||    
24075307 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaagtgtcaggccaactcctaaccg 24075406  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
24075407 atgtgggactcttaaca 24075423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 42846604 - 42846723
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccc-ccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||| |||||||||||| ||||||     
42846604 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggccaactcctaa 42846703  T
236 ccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||    
42846704 ccgatgtgagactcttaaca 42846723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 10450085 - 10449967
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||| |||||| |||||| |||||||||| |||||| |||||||||||||||||||||||||| |||||||    
10450085 tcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattgcccacacttataaacacattgtcaggccatgtcctatc 10449986  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
10449985 cgatgtgagactcttaaca 10449967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 12317131 - 12317013
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| ||||||||||| |||| |||||||||| |||||||||||||||||||||||||||| |||| |||| ||    
12317131 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcagcttatgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtc 12317032  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
12317031 cgatgtgggactcttaaca 12317013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 5590369 - 5590485
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||| ||||||| |||||||||| |||||| |||||||||||| ||||||||||||||| ||||||||||||||    
5590369 ttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccg 5590468  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||| ||||    
5590469 atgtgggactctgaaca 5590485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 7267466 - 7267582
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||||||||||||| |||||||||||| |||||| ||||||||||||||| | ||||||||||||||||||| ||||||| |||| |||||| |||    
7267466 ttagaaatggtggttgggtctaacacaaccctacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaagccaactcctaaccg 7267565  T
239 atgtgtgactcttaaca 255  Q
    |||||||||||||||||    
7267566 atgtgtgactcttaaca 7267582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 140 - 251
Target Start/End: Complemental strand, 4828375 - 4828264
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||| |||||| ||||    
4828375 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccga 4828276  T
240 tgtgtgactctt 251  Q
    |||| |||||||    
4828275 tgtgggactctt 4828264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 248
Target Start/End: Original strand, 5932183 - 5932294
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| ||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||||| || |||| |||||||    
5932183 tcttaaaaatggtggttgggcctaacacaaccccacaaaacaggcttgtgaggtgaggcttgcccccacttataaacacattgttagaccatgtcctatc 5932282  T
237 cgatgtgtgact 248  Q
    ||||||| ||||    
5932283 cgatgtgggact 5932294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 37001549 - 37001435
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||||||| |||||||||||| |||| ||    
37001549 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaacactttgtcaggccatttcctgtc 37001450  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
37001449 cgatgtgagactctt 37001435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 8929101 - 8928997
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||| | ||||||||||||||||||||||||||||| |||||||||||||| || ||||||||| |||||||||||||||||||||||||| |||||    
8929101 cttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaacacattgtcaggccatctcatatcc 8929002  T
238 gatgt 242  Q
    |||||    
8929001 gatgt 8928997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 3157558 - 3157677
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||| |||||||||||| |||||||||||||||||||||  |||||||||||||||| ||| |||||||||||||| |||||| ||||||||| |||||    
3157558 tcttataaatggtggttgagcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctat 3157657  T
236 ccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||    
3157658 ccgatgtgggactcttaaca 3157677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 20301346 - 20301227
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||| |||||||  |||||||||||| ||| ||||||||||||||||||||||||||| |||||||| ||||    
20301346 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 20301247  T
237 cgatgtgtgactcttaacac 256  Q
    | |||||  |||||||||||    
20301246 caatgtggtactcttaacac 20301227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 21087978 - 21087859
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||| |||||||  |||||||||||| ||| ||||||||||||||||||||||||||| |||||||| ||||    
21087978 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatc 21087879  T
237 cgatgtgtgactcttaacac 256  Q
    | |||||  |||||||||||    
21087878 caatgtggtactcttaacac 21087859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 136 - 251
Target Start/End: Original strand, 22638177 - 22638292
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||| |||||||||||||||||| ||||||||| ||||||| ||||||| |||||||||||| ||| ||||||||||| |||    
22638177 ttcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttat 22638276  T
236 ccgatgtgtgactctt 251  Q
    |||||||| |||||||    
22638277 ccgatgtgagactctt 22638292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 136 - 255
Target Start/End: Complemental strand, 25325732 - 25325613
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||||||| ||||| ||||||||  ||||||||||| |||| |||| |||||||||||||||||||| ||||||| ||||||    
25325732 ttcttagaaatcgtggttgggcctaaaacaactccacaaaactggcttgtgaggagaggattgcacccacttataaacacattgttaggccatgtcctat 25325633  T
236 ccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||    
25325632 ccgatgtgggactcttaaca 25325613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 3157326 - 3157442
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| |||||||||||||||||||||||||||||   |||||    
3157326 tcttagaaatggtggttgggcctaacacaaccccacaaaa-cagcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca---cctat 3157421  T
236 ccgatgtgtgactcttaacac 256  Q
    || ||||| ||||||||||||    
3157422 cccatgtgagactcttaacac 3157442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 153 - 243
Target Start/End: Original strand, 38447442 - 38447532
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||    
38447442 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatctcttatccgttgtg 38447532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 422218 - 422335
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||| ||||||||| ||||||||||||  |||||||||||||||| ||||| |||||| ||||||||||||||| ||||||||||||||    
422218 ttagaaatcgtggtttggcctaacataaccccacaaaactggcttgtgaggtgaggattgcctccacttttaaacacattgtcagaccatctcctatccg 422317  T
239 atgtgtgactcttaacac 256  Q
    ||||| |||| |||||||    
422318 atgtgggacttttaacac 422335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 28069358 - 28069475
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||  |||||||||| |||||||||| | ||||||||||||| ||||||||||||||||| ||||||||||||||| || ||||||    
28069358 ttagaaatcgtggttggatctaacacaactccacaaaatcagtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccg 28069457  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
28069458 atgtgggactcttaacac 28069475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 136 - 255
Target Start/End: Original strand, 35385809 - 35385929
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||||||||||||||| || |||||||||||||||||| |||||| |||||||||| ||| |||||||||||||||| ||| |||||| |||| |||    
35385809 ttcttagaaatggtggttgagcttaacacaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttcta 35385908  T
235 tccgatgtgtgactcttaaca 255  Q
    ||||||||| |||||||||||    
35385909 tccgatgtgggactcttaaca 35385929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 18939296 - 18939409
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||| ||  ||||||||||||  | |    
18939296 tcttagaaatggtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaaca-atattcaggccatctctcaac 18939394  T
237 cgatgtgtgactctt 251  Q
    ||||||||| |||||    
18939395 cgatgtgtggctctt 18939409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 4828151 - 4828039
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| ||||||| | || |||||| |||    
4828151 ttagagatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaattgtcatgtcaactcctaaccg 4828052  T
239 atgtgtgactctt 251  Q
    ||||| |||||||    
4828051 atgtgggactctt 4828039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 18004095 - 18004215
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||| ||||||| || ||| || ||||||| ||||||||||||||||||| ||||||||||||| |||| ||    
18004095 tcttagaaatcttggttgggcctaacacaacctcacaaaaccgacttatggggtgaggattgcccccacttataaacatattgtcaggccatgtcctgtc 18004194  T
237 cgatgtgtgactcttaacacc 257  Q
     |||||| |||||||||||||    
18004195 tgatgtgggactcttaacacc 18004215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 34842761 - 34842645
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| ||||||||||||||||||||| || | | |||||||||| ||||||||||||||||||| |||||||||||| |||||| | |    
34842761 ttagaaatcgtggttgagcctaacacaaccccacaaaaccgacctatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactg 34842662  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
34842661 atgtgggactcttaaca 34842645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 41790743 - 41790624
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||| |||||| |||||| |||||||||| ||| ||||||||||||||||||||||||| |||| |||||     
41790743 tcttagaaatcgtggttgggcctaacacaaccc-acaaaaccggcttatgaggtgaggattgtccccacttataaacacattgtcaggtcatcacctatt 41790645  T
237 cgatgtgtgactcttaacacc 257  Q
    |||||||  ||| ||||||||    
41790644 cgatgtggaacttttaacacc 41790624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 12547183 - 12547065
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || |||||||||||||||||||||||||| ||||||||||||||| | ||| ||||||||||||| | |||||||| ||| |||||| |    
12547183 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattg-ccccacttataaataaattgtcagaccaactcctaac 12547085  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
12547084 cgatgtgggactcttaacac 12547065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 12688392 - 12688277
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||| |||| |||||||||||||||  |||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |||||    
12688392 tcttagaaatcatggttggacctatcacaaccccacaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcaggtcatcttctatc 12688293  T
237 cgatgtgtgactctta 252  Q
    | ||||| ||||||||    
12688292 caatgtgggactctta 12688277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 140 - 250
Target Start/End: Original strand, 26800514 - 26800624
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||| ||| |||||||| || ||| ||||    
26800514 tagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgtggtgaggattgcccccacttatagacaaattatcaggccaacttctaaccga 26800613  T
240 tgtgtgactct 250  Q
    |||| ||||||    
26800614 tgtgggactct 26800624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 36917438 - 36917556
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||| || ||||||||||||||||||  | ||||||| |||||| || |||||||||||||| |||||||||||||||  ||||||    
36917438 tcttagaaatggtggttgtgcttaacacaaccccacaaaactgacttgtgatgtgaggattacccccacttataaatacattgtcaggccattacctatc 36917537  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
36917538 tgatgtgagactcttaaca 36917556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 3157008 - 3157127
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccc-cacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||||||| ||| ||||||||||||||||||||| |  |||||||||||||| ||||||| ||||||||||||||||||  |||||||  ||||    
3157008 tcttagaaatggtgattgagcctaacacaaccccacaaaa-catcttgtgaggtgaggattgccccccacttataaacacattgttgggccatcatctat 3157106  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
3157107 ccgatgtgagactcttaacac 3157127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 227
Target Start/End: Complemental strand, 10884149 - 10884059
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacattgtcaggcca 227  Q
    |||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||    
10884149 tcttagaaatcgtggttgggcctaacacaaccc-acaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca 10884059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 158 - 256
Target Start/End: Complemental strand, 34843181 - 34843083
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||| ||||| || ||| |||||| |||||||| ||||||||||||    
34843181 ctaacacaaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattgttagaccaactcctaaccgatgtgggactcttaacac 34843083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 231
Target Start/End: Complemental strand, 37001311 - 37001217
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||| ||||| |||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||| ||||||||| |||| ||||||||||    
37001311 tctttgaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacctataaacactttgtgaggccatctc 37001217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 28213105 - 28213221
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||| | |||| |||||||||||||||| ||| || ||||||||||||||||||||| ||||||| ||||      
28213105 ttagaaatcgtggttgggcctaacacaaccccgccaaattggcttgtgaggtgaggattg-ccgcacttataaacacattgtcagaccatctcatatctt 28213203  T
239 atgtgtgactcttaacac 256  Q
    ||| | ||||||||||||    
28213204 atgcgggactcttaacac 28213221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 27205051 - 27204975
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||    
27205051 attcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 27205149 - 27205073
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||    
27205149 attcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 248
Target Start/End: Complemental strand, 8084212 - 8084101
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||||||| || ||||| | ||||||||||||||| ||||||||||||||||| |||||||||| | || |||| ||    
8084212 tcttagaaatcgtggttgggtctaacacaactccgcaaaaccagcttgtgaggtgaggattgcccccacttataaatacattgtcagactatgtcctgtc 8084113  T
237 cgatgtgtgact 248  Q
    ||||||| ||||    
8084112 cgatgtgggact 8084101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 8084447 - 8084328
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| |||||||||||| |||||||  || ||||||||||||| || |||||||||||||| ||||||| ||||||| || | |     
8084447 tcttagaaatcgtggttggacctaacacaacctcacaaaactggtttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgtt 8084348  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
8084347 cgatgtgggactcttaacac 8084328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 136 - 231
Target Start/End: Complemental strand, 38476363 - 38476268
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||||||| | |||||| | |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |  ||||||||||||    
38476363 ttcttagaatttgtggttagtcctaacacaaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaacacttattcaggccatctc 38476268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 159 - 254
Target Start/End: Complemental strand, 39984877 - 39984782
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    ||||||||||||||||||  |||||||||||||||| ||||||||||||||||||| |||||||| ||| ||||||  ||||||| ||||||||||    
39984877 taacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaatcgatgtgagactcttaac 39984782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 27205245 - 27205171
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||    
27205245 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 215
Target Start/End: Complemental strand, 38475832 - 38475754
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| | |||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||    
38475832 tcttagaatttgtggttgggcctaacacaaccctacaaaaccggcttgtgaggtgaggattgcccccacttataaacac 38475754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 154 - 251
Target Start/End: Complemental strand, 7730009 - 7729912
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||| || ||  |||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||| |||||| |||||||    
7730009 gggcctaactcatccttacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatggtcaggccatctcatatctgatgtgggactctt 7729912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 139 - 240
Target Start/End: Complemental strand, 8716197 - 8716096
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  |||||||| |||||||||||||||||||||||||| |||||||||| |||||  ||||| |||||||||||| || ||||||| ||||||    
8716197 ttagaaatcttggttgggtctaacacaaccccacaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgtgagaccatctcttatccg 8716098  T
239 at 240  Q
    ||    
8716097 at 8716096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 34653233 - 34653117
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||| || ||| ||  || |||||||||||| ||||||||  || |||||| |||    
34653233 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgttaggatt-acctcacttataaacaaattgtcagatcaactcctaaccg 34653135  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
34653134 atgtgagactcttaacac 34653117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 16050112 - 16049996
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||| | ||||||||| |||||||||||||||||||  | |||||||||||||| |||||  |||||||||||| ||| |||||||| |||||| |||    
16050112 ttagaagtcgtggttgggtctaacacaaccccacaaaactgacttgtgaggtgaggattgccttcacttataaacaaattatcaggccaactcctaaccg 16050013  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||| ||||||    
16050012 atgtgagacttttaaca 16049996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 31197932 - 31197812
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||| | ||||||||||||| ||||| |||  | |||||||||||||| ||| | ||||||| |||||||||||||||||||| ||||||    
31197932 tcttaaaaattgtgatcgggcctaacacaatcccaccaaactgacttgtgaggtgaggattgtctccacttacaaacacattgtcaggccatcacctatc 31197833  T
237 cgatgtgtgactcttaacacc 257  Q
     |||||| |||||||||||||    
31197832 tgatgtgggactcttaacacc 31197812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 153 - 256
Target Start/End: Complemental strand, 16050329 - 16050227
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctta 252  Q
    |||| ||||||||||||||||||| |||||| |||||||||| ||| || |||||||||| | |||||||||||| |||||| |||||||| ||||||||    
16050329 tgggtctaacacaaccccacaaaaccggctt-tgaggtgaggattgtcctcacttataaataaattgtcaggccaactcctaaccgatgtgagactctta 16050231  T
253 acac 256  Q
    ||||    
16050230 acac 16050227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 136 - 236
Target Start/End: Complemental strand, 20301593 - 20301487
Alignment:
136 ttcttagaaatggtggttgggcctaacacaacc------ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    ||||||||||| |||||||||||||||||||||      ||||| || ||||||||| ||||||| ||||||||||||||||||||||||||| ||||||    
20301593 ttcttagaaatcgtggttgggcctaacacaacctcaaaaccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatc 20301494  T
230 tcctatc 236  Q
    || ||||    
20301493 tcatatc 20301487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 232
Target Start/End: Complemental strand, 20515229 - 20515134
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    ||||| |||| ||||||| | || ||| |||||||||||| |||||||||| |||||| ||||||| |||||||||||||||||||||||||||||    
20515229 tcttataaattgtggttgaggctgacataaccccacaaaaccggcttgtgatgtgaggattgccccgacttataaacacattgtcaggccatctcc 20515134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 136 - 236
Target Start/End: Complemental strand, 21088225 - 21088119
Alignment:
136 ttcttagaaatggtggttgggcctaacacaacc------ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    ||||||||||| |||||||||||||||||||||      ||||| || ||||||||| ||||||| ||||||||||||||||||||||||||| ||||||    
21088225 ttcttagaaatcgtggttgggcctaacacaacctcaaaaccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatc 21088126  T
230 tcctatc 236  Q
    || ||||    
21088125 tcatatc 21088119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 143 - 254
Target Start/End: Original strand, 29099745 - 29099856
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||||| ||| | |||||||| ||||||||||||| | ||||||||||| | ||||| |||||||||||||||||||||| |||||| |||| |||| |    
29099745 aaatggtagttagacctaacactaccccacaaaatcagtttgtgaggtgaagattgcctccacttataaacacattgtcagaccatcttctattcgatat 29099844  T
243 gtgactcttaac 254  Q
    | ||||||||||    
29099845 gagactcttaac 29099856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 243
Target Start/End: Complemental strand, 29005949 - 29005843
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||| || ||| ||||||| ||| |||||| |||  |||||||||||||| ||||||||| |||||||||||    
29005949 tcttagaaatcgtggttgggtctaacacaacctcataaattcggcttatgaagtgaggattgttcccacttataaacatattgtcaggtcatctcctatc 29005850  T
237 cgatgtg 243  Q
    | |||||    
29005849 caatgtg 29005843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 182 - 256
Target Start/End: Original strand, 39052581 - 39052655
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| |||||||| |||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||    
39052581 ttgttaggtgaggattgcccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaacac 39052655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 42049686 - 42049800
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||| ||||||| ||||||| ||||||||| ||||||| ||||||||||||||||||||||   ||||||||||  | ||    
42049686 tcttagaaatcgtggttaggcctaccacaacctcacaaaaccggcttgtggggtgaggattgcccccacttataaacacatgtccaggccatcttttgtc 42049785  T
237 cgatgtgtgactctt 251  Q
    | |||| ||||||||    
42049786 caatgtttgactctt 42049800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 137 - 221
Target Start/End: Original strand, 15042885 - 15042969
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtc 221  Q
    |||||||||| |||||| |||||||||||||||||||||| ||| ||  ||||| ||| ||||||||||||||||||||||||||    
15042885 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggtttacgaggtaaggattgcccccacttataaacacattgtc 15042969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 138 - 241
Target Start/End: Original strand, 20094795 - 20094897
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||| |||| |||||||||||||| |||||||||||||| |||||||| |||||||| |||||||||| |||||||| ||||| || ||||||  |||||    
20094795 cttataaatcgtggttgggcctaa-acaaccccacaaaaccggcttgtaaggtgaggattgcccccacatataaacatattgtaagaccatcttttatcc 20094893  T
238 gatg 241  Q
    ||||    
20094894 gatg 20094897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 136 - 251
Target Start/End: Original strand, 30201522 - 30201637
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||| ||||| ||||||||||| |||| | | |||||||| ||||||||||||||| | ||| ||||||||||||||  |||| || |||||||| |||    
30201522 ttcttcgaaatcgtggttgggccaaacatagctccacaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttat 30201621  T
236 ccgatgtgtgactctt 251  Q
    |||||||| |||||||    
30201622 ccgatgtgggactctt 30201637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 6542002 - 6541880
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggtt-gcccccacttataaacacattgtcaggccatctcct 233  Q
    |||||||||| | | ||||||||||||||||| ||||||||| ||||||||||||||||| ||  ||||||||||||| ||| |  ||||||||||||      
6542002 attcttagaatttgcggttgggcctaacacaaacccacaaaaccggcttgtgaggtgaggattaccccccacttataagcacttgttcaggccatctcac 6541903  T
234 atccgatgtgtgactcttaacac 256  Q
     ||| ||||| ||||||||||||    
6541902 ttccaatgtgggactcttaacac 6541880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 8466723 - 8466837
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |  ||||||||||| |||| | ||||||||||||||| ||| ||||||||||||||||    ||| |||||||| ||||    
8466723 tcttagaaattgtggttgggtcgtacacaaccccataaaaccagcttgtgaggtgaggattgtccccacttataaacactcgttcatgccatctcttatc 8466822  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
8466823 cgatgtgagactctt 8466837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 158 - 255
Target Start/End: Complemental strand, 20702861 - 20702763
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||| ||||||| |||||| |||| ||||| |||||||| ||||||||||| | |||||||||| |||||| |||||||| |||||||||||    
20702861 ctaacacaacctcacaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaaca 20702763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 149 - 255
Target Start/End: Complemental strand, 31197688 - 31197582
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    ||||||||||||||||||||| |||||| || ||| |||||||||  || |||  |||||||||||||||||||| ||||| |||||| |||||  ||||    
31197688 tggttgggcctaacacaaccctacaaaaccgacttttgaggtgagaattacccttacttataaacacattgtcagaccatcacctatctgatgtaggact 31197589  T
249 cttaaca 255  Q
    |||||||    
31197588 cttaaca 31197582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 36907427 - 36907541
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||  ||||||||||||||||||||||||| |||  ||||||| | |||||  |||||||||||| | ||||||||||||| ||||||| ||||    
36907427 tcttagaaagtgtggttgggcctaacacaaccccaccaaactggcttgtaatgtgagaattgcccccacttttgaacacattgtcagaccatctcttatc 36907526  T
237 cgatgtgtgactctt 251  Q
     || ||| |||||||    
36907527 tgacgtgggactctt 36907541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 228
Target Start/End: Original strand, 422452 - 422543
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||||| ||||||||||| |||||||||||||||||||||||| |||| ||| | ||||   |||||||||||| |||||||| ||||    
422452 tcttagaaattgtggttgggccaaacacaaccccacaaaatcggcttatgagctgatgattgcatacacttataaacatattgtcagaccat 422543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 157 - 256
Target Start/End: Original strand, 5675753 - 5675852
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||| |||||||||| ||||||||||||||  ||| | | |||||||||||||||||||| |||||  |||||||||||  ||||||| ||||    
5675753 cctaacacaactccacaaaatcagcttgtgaggtgagaattgtctctacttataaacacattgtcagaccatcatctatccgatgtaggactctttacac 5675852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 141 - 243
Target Start/End: Original strand, 4873694 - 4873795
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| |||||||||||||| |  ||  ||||||| ||||||||||||||||  ||||| | ||||||||||||||||||||| |||||| ||||||||    
4873694 agaaattgtggttgggcctaataagacaacacaaaaccggcttgtgaggtgagaattgccac-acttataaacacattgtcaggtcatctcttatccgat 4873792  T
241 gtg 243  Q
    |||    
4873793 gtg 4873795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 10614938 - 10615052
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||| | || |||||| || |||||||||  ||| | ||| |  ||||    
10614938 tcttataaatcgtggttgagcctaatacaaccccacaaaatcggcttgtgaggtgaagattacccccatttgtaaacacatgttcatgtcatattttatc 10615037  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
10615038 cgatgtgggactctt 10615052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 181 - 251
Target Start/End: Original strand, 29907769 - 29907839
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||| ||| |||||||||||||||||||||||| | ||||| ||||||||||| |||||||    
29907769 cttgtgaggtgaggattgaccccacttataaacacattgtcagactatctcttatccgatgtgggactctt 29907839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 37868582 - 37868696
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| |||||| ||||||||||||  |||||||| | ||||||||||||||| ||||||||| | ||||||||||  ||||||||||   | ||    
37868582 tcttaaaaatcgtggttaggcctaacacaattccacaaaaccagcttgtgaggtgaggattgcccccattaataaacacatgttcaggccatcatttgtc 37868681  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
37868682 cgatgtgggactctt 37868696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 4963437 - 4963384
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||||||||    
4963437 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtga 4963384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 151 - 232
Target Start/End: Original strand, 27439560 - 27439641
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    |||| |||| ||||||| |||||||| | |||||||||| |||| ||| ||| |||||||||||||||||||||||||||||    
27439560 gttgagcctgacacaacgccacaaaaccagcttgtgaggcgaggattgaccctacttataaacacattgtcaggccatctcc 27439641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 34236692 - 34236753
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||||||||| |||| ||||||||||||||||||||||| ||||||| |||||||||||    
34236692 ttgtgaggtgaggattgctcccacttataaacacattgtcagaccatctcttatccgatgtg 34236753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 41790955 - 41790882
Alignment:
137 tcttagaaatggtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttat 209  Q
    |||||||||| |||||| | ||||||||| |||| ||||| |||||||||||||||||||||||||||||||||    
41790955 tcttagaaatcgtggttcgccctaacacaccccccacaaattcggcttgtgaggtgagggttgcccccacttat 41790882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 160 - 251
Target Start/End: Complemental strand, 5940120 - 5940029
Alignment:
160 aacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||| ||||||   ||||||||||||||| ||| ||||| |||||||||||||||||  |||||||  |||||||||| |||||||    
5940120 aacacaaccctacaaaacttgcttgtgaggtgaggattgtccccatttataaacacattgtcaaaccatctctcatccgatgtgggactctt 5940029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 243
Target Start/End: Complemental strand, 6463043 - 6462938
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| |||||||||| |||||||||| ||||||| | | |||| | | |||| ||||| ||||||||||||||||||||| | |||||| ||||    
6463043 tcttaaaaattgtggttgggcataacacaaccgcacaaaacctgtttgttaagcgagg-ttgcctccacttataaacacattgtcaagtcatctcttatc 6462945  T
237 cgatgtg 243  Q
    |||||||    
6462944 cgatgtg 6462938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 223
Target Start/End: Complemental strand, 12688157 - 12688071
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    |||||||||| ||| ||| | |||||| ||| |||||||| |||||||||||||| || |||||| |||||||||||||||| ||||    
12688157 tcttagaaatcgtgtttgagtctaacataactccacaaaaccggcttgtgaggtggggattgccctcacttataaacacattatcag 12688071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 182 - 256
Target Start/End: Original strand, 20094604 - 20094678
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| |||| ||| ||| |||||| |||||||||||||||||||||||| |||| ||||||| ||||||||||||    
20094604 ttgtaaggtaaggattgtccccacatataaacacattgtcaggccatcttctattcgatgtgggactcttaacac 20094678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 224
Target Start/End: Complemental strand, 42584755 - 42584672
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg 224  Q
    |||||||| | |||||| ||||||||||    |||||||||||||| || |||||||  |||||||||||||||||||||||||||||    
42584755 tcttagaatttgtggttaggcctaacac----ccacaaaatcggctggtaaggtgagtattgcccccacttataaacacattgtcagg 42584672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 168 - 228
Target Start/End: Complemental strand, 7669695 - 7669635
Alignment:
168 cccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    ||||||||| |  |||||||||||||| |||||||||||||||||||||||||||| ||||    
7669695 cccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 7669635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 136 - 220
Target Start/End: Original strand, 15797049 - 15797132
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt 220  Q
    ||||||||||| |||||||| |||| ||||||||||||||| | || |||||||||||| |||  | ||||||||||||||||||    
15797049 ttcttagaaattgtggttgg-cctagcacaaccccacaaaacctgcgtgtgaggtgaggattgttctcacttataaacacattgt 15797132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 40014743 - 40014663
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| |||||| ||||| ||| || ||||||||| || ||||||| |||| | ||||||||||||||||||||||    
40014743 tcttagaaatcgtggtttggcctgacagaagcccacaaaaccgacttgtgaagtgaagattgcccccacttataaacacat 40014663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 44931215 - 44931295
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||| |||||||||||| |||| |||||||||||||||||||| |  ||||||||||||  | |||||||| |||||||    
44931215 acaaaaccggcttgtgaggcgaggattgcccccacttataaacacttattcaggccatctctcaaccgatgtgggactctt 44931295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 45031373 - 45031437
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||||||||||||  |||||| |||||||| |||||||| ||||||| |||||||||||    
45031373 ggttgggcctaacacaaccttacaaaaccggcttgtaaggtgaggattgccccgacttataaaca 45031437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 148 - 231
Target Start/End: Original strand, 6559459 - 6559542
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||||||| | |||| |||| ||||||| |||||||| |||||||| ||||||||||||||||||| ||  | ||||||||||    
6559459 gtggttgggacgaacataacctcacaaaaccggcttgtaaggtgaggattgcccccacttataaacatatctttaggccatctc 6559542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 156 - 255
Target Start/End: Complemental strand, 7669485 - 7669386
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||| | | |||| || ||| | |||||||||||||||||||| ||||||  |||||| |||||||||||  | |||||||||    
7669485 gcctaacataaccccacaaaaccagtttgtaagatgatgattgcccccacttataaacacgttgtcaaaccatcttctatccgatgtagggctcttaaca 7669386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 138 - 217
Target Start/End: Original strand, 15686040 - 15686119
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||| ||||||| | ||||||||| ||||||||| ||||||||||||||||  ||   |||||||||||||||||    
15686040 cttagaaatcgtggttgagtctaacacaatcccacaaaaccggcttgtgaggtgagaatttttcccacttataaacacat 15686119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 28213319 - 28213434
Alignment:
137 tcttagaaatggtggttgggcctaacacaacc-ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||| | ||||| | ||||||||||  |||||||| || |||||||||||||   || ||||||||||||| |||||||||| | ||||| |||    
28213319 tcttagaaattgaggttgtgtctaacacaacttccacaaaaccgacttgtgaggtgagaaatgtccccacttataaatacattgtcagactatctcttat 28213418  T
236 ccgatgtgtgactctt 251  Q
    |||||||  |||||||    
28213419 ccgatgtaagactctt 28213434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 169 - 251
Target Start/End: Original strand, 37868379 - 37868461
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||| ||||||||||||||||| ||||||||||| |||||||| |  ||||||||||   ||||||||||  |||||||    
37868379 ccacaaaaccggcttgtgaggtgaggattgcccccactaataaacacgtgttcaggccatcatttatccgatgttcgactctt 37868461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 10454511 - 10454454
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||| ||||||| |||||||||||||| |||||| |||||| ||||||||||    
10454511 tcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgagg 10454454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 16962245 - 16962322
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    ||||| |||| |||||||| |||||||||| ||||||||| ||| ||||||||||||  |||  ||||||||||||||    
16962245 tcttaaaaattgtggttggacctaacacaatcccacaaaaccggtttgtgaggtgagaattgttcccacttataaaca 16962322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 139 - 192
Target Start/End: Original strand, 26208013 - 26208066
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||||||| |||||||||||||||| |||||||||||| |||||| ||||||||    
26208013 ttagaaattgtggttgggcctaacataaccccacaaaaccggcttatgaggtga 26208066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 149 - 226
Target Start/End: Original strand, 30953015 - 30953086
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggcc 226  Q
    ||||||||||||||||| |||||||||||||||||||||||      ||||||||||||||||||||||  |||||||    
30953015 tggttgggcctaacaca-ccccacaaaatcggcttgtgagga-----ttgcccccacttataaacacatgttcaggcc 30953086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 137 - 228
Target Start/End: Original strand, 26482675 - 26482764
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||||||||| ||| |||| |||||||||| || | |||||||||||||||| ||||| ||| |||||||||||||| ||  ||||||||||    
26482675 tcttagaaatcgtgattgg-cctaacacaatcctaaaaaatcggcttgtgagttgaggattg-ccccacttataaactcaaggtcaggccat 26482764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 251
Target Start/End: Original strand, 3961426 - 3961512
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||| | | |||||||||||   |||| |||| ||||||||||||||||||  |||||| |||| |||||| |||||||    
3961426 aaccccacaaaaccagtttgtgaggtgataattgctcccatttataaacacattgtcagctcatctcttatctgatgtgggactctt 3961512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 181 - 255
Target Start/End: Original strand, 4873500 - 4873574
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||  || |||||||| ||||   ||||||||| ||||||| ||||||||||| |||||||||||    
4873500 cttgtgaggtgagtattacccccactgataactgcattgtcagaccatctcttatccgatgtgggactcttaaca 4873574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 251
Target Start/End: Complemental strand, 6463249 - 6463163
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||| ||||||| ||||| ||||  ||| | || |||||||||||||||| ||||||||| | |||| ||||||||||| |||||||    
6463249 aaccgcacaaaaccggctcgtgacatgaagattacccccacttataaacaaattgtcaggtcttctcatatccgatgtgagactctt 6463163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 148 - 253
Target Start/End: Complemental strand, 8715977 - 8715871
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtga-ggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtga 246  Q
    ||||||||||||||| ||||| || |||| || ||||||| ||||||  |||||| |||||||| ||| ||||||| |  |||||  |||||||||| ||    
8715977 gtggttgggcctaacccaacctcaaaaaaccgacttgtgatggtgagaattgccctcacttatagacatattgtcaagttatctctcatccgatgtgaga 8715878  T
247 ctcttaa 253  Q
    |||||||    
8715877 ctcttaa 8715871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Original strand, 19472314 - 19472368
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| ||||||||||||  ||||| |||||||| ||||||||||||    
19472314 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19472368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Original strand, 19543239 - 19543293
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| ||||||||||||  ||||| |||||||| ||||||||||||    
19543239 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19543293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Complemental strand, 19589457 - 19589403
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| ||||||||||||  ||||| |||||||| ||||||||||||    
19589457 ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacac 19589403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Original strand, 39052770 - 39052812
Alignment:
214 acattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||||| ||||||||||||| ||||||||||||    
39052770 acattgtcaggccatcacctatccgatgtgggactcttaacac 39052812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 8466532 - 8466593
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||||||||| || ||||||||||||||||| |  |||| ||||||| |||||||||||    
8466532 ttgtgaggtgaggatttcccccacttataaacacttgttcagaccatctcttatccgatgtg 8466593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 135 - 176
Target Start/End: Original strand, 24532283 - 24532324
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    ||||||||| || |||||||||||||||||||||||||||||    
24532283 attcttagagatcgtggttgggcctaacacaaccccacaaaa 24532324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 26208248 - 26208325
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||||| |||| ||| ||||||||||||||| ||||  ||||| ||| |||  | |||||||||||||||||||    
26208248 tcttagaaattgtggatggacctaacacaaccccataaaactggcttatgatgtggagattgcccccacttataaaca 26208325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 150 - 219
Target Start/End: Original strand, 30966079 - 30966148
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattg 219  Q
    ||||||||||||| |||    |||||| |||||||| ||||||||  |||||||||||||||||||||||    
30966079 ggttgggcctaactcaaatttacaaaaccggcttgtaaggtgaggactgcccccacttataaacacattg 30966148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 135 - 223
Target Start/End: Original strand, 36917253 - 36917342
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg-agggttgcccccacttataaacacattgtcag 223  Q
    |||||||||| ||||| ||  |||||||| |||  || |||||||| ||||||| || ||| ||||| ||||||||||||||||||||||    
36917253 attcttagaagtggtgatttagcctaacaaaacttcataaaatcggtttgtgagatggaggattgcctccacttataaacacattgtcag 36917342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 186
Target Start/End: Complemental strand, 38476123 - 38476074
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtg 186  Q
    |||||||||| |||||||||||||||| || ||||||||| |||||||||    
38476123 tcttagaaattgtggttgggcctaacataatcccacaaaaccggcttgtg 38476074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 44694707 - 44694756
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgt 185  Q
    ||||||||| | |||||||||||||||||||||||||||||  |||||||    
44694707 ttcttagaatttgtggttgggcctaacacaaccccacaaaactggcttgt 44694756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 45122418 - 45122373
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||||||||||||||||| ||| |||||||| ||||||||    
45122418 tggttgggcctaacacaaccccacgaaaccggcttgtaaggtgagg 45122373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 201
Target Start/End: Original strand, 10615155 - 10615219
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccc 201  Q
    |||||||||| |||||||||| |||| |||||||||||||   |||||| |||||||| ||||||    
10615155 tcttagaaattgtggttgggcttaacgcaaccccacaaaactagcttgttaggtgaggattgccc 10615219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 179 - 251
Target Start/End: Original strand, 31079603 - 31079675
Alignment:
179 ggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||||| ||||| ||||||||||||||||  ||| ||||| |  || |||||||| |||||||    
31079603 ggcttgtgaggtgaggattgcctccacttataaacacatgttcaagccatattttacccgatgtgggactctt 31079675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 169 - 229
Target Start/End: Original strand, 37868103 - 37868163
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    |||||||| ||||||||| ||||||| ||||||||||| |||||||| |  ||||||||||    
37868103 ccacaaaaccggcttgtgtggtgaggattgcccccactaataaacacgtgttcaggccatc 37868163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 152 - 251
Target Start/End: Original strand, 12022402 - 12022501
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||| |||| |||||  ||||||| |||||||| || || | |||||||||||| |  | |||||| ||| ||||| ||||| |||||||    
12022402 ttgggcctaacacatccccgcaaaactggcttgtaaggtgaggatttccgctacttataaacacttgttgaggccacctcttatccaatgtgggactctt 12022501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 217
Target Start/End: Original strand, 16962077 - 16962160
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||||||| ||||||||| ||   ||||||  ||||| |||||||||||| ||| | || ||| |||||||||||||||    
16962077 gattcttagaaatcgtggttgggtctgggacaacctaacaaactcggcttgtgagatgatgattaccctcacttataaacacat 16962160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 5676055 - 5676173
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| |||||| ||  | || |||||| | || |||| | ||| ||||| ||| ||||||| ||||||||||| |||| | |||     
5676055 tcttagaaatcgtggttggacctaacgcagtctcataaaatcagtttttgagataaggattgcctccatttataaatacattgtcaggtcatcacatatt 5676154  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
5676155 tgatgtgggactcttaaca 5676173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 152 - 186
Target Start/End: Complemental strand, 25940829 - 25940795
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtg 186  Q
    |||||||||||||| ||||||||||||||||||||    
25940829 ttgggcctaacacagccccacaaaatcggcttgtg 25940795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 31079809 - 31079875
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    ||||||| | |||||||| ||||||||||  ||||| |||||||||| |||| | ||||||||||||    
31079809 gtggttgagtctaacacagccccacaaaactggcttttgaggtgaggattgctctcacttataaaca 31079875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 37867863 - 37867909
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| ||||||||||||||||  ||||||||||| ||||||||    
37867863 ccacaaaaccggcttgtgaggtgagaattgcccccactaataaacac 37867909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 7729739 - 7729694
Alignment:
198 gcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||| |||| ||||||||||||||||||||| |||| ||||||    
7729739 gcccccaattattaacacattgtcaggccatctcatatctgatgtg 7729694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 10615716 - 10615635
Alignment:
137 tcttagaaatggtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||  ||||||| |||||| |||||||| |||||| || ||||| ||| |||| || ||| |||||||||||||||    
10615716 tcttagaaaccgtggttgagcctaatacaacccccacaaaaccgacttgtaaggagaggattaccctcacttataaacacat 10615635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 31079365 - 31079414
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||| ||||| ||||||||||||||||| |||||| ||||| ||||||    
31079365 aaccccgcaaaaccggcttgtgaggtgaggattgccctcacttctaaaca 31079414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 206 - 255
Target Start/End: Complemental strand, 44354071 - 44354023
Alignment:
206 ttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||| ||||||||| ||||||||||||| ||||| |||||    
44354071 ttataaacacattg-caggccatcacctatccgatgtgggactcctaaca 44354023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 13051440 - 13051524
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||| | |||||| ||||||||||| | ||||||||||| |||||| ||||||| | ||   ||| ||||| |||||||||||    
13051440 acaaaaccagcttgtaaggtgagggttacacccacttataaccacattttcaggccttatctcctccaatgtgggactcttaaca 13051524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 96; Significance: 9e-47; HSPs: 125)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 21861614 - 21861495
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||    
21861614 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 21861515  T
237 cgatgtgtgactcttaacac 256  Q
    |||||||  |||||||||||    
21861514 cgatgtggaactcttaacac 21861495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 21054952 - 21055070
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||    
21054952 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatc 21055051  T
237 cgatgtgtgactcttaaca 255  Q
    |||| || |||||||||||    
21055052 cgatatgggactcttaaca 21055070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 47710528 - 47710410
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||    
47710528 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatc 47710429  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
47710428 cgatgtgagactcttaaca 47710410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 47722184 - 47722066
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||    
47722184 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatc 47722085  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
47722084 cgatgtgagactcttaaca 47722066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 140 - 256
Target Start/End: Complemental strand, 3393064 - 3392948
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||| |||||||||    
3393064 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattttccccacttataaacacattgtcaggccatcacctatccga 3392965  T
240 tgtgtgactcttaacac 256  Q
    |||| ||||||||||||    
3392964 tgtgagactcttaacac 3392948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 29469688 - 29469572
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||||    
29469688 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccg 29469589  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
29469588 atgtgggactcttaaca 29469572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 36277225 - 36277344
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| || | ||    
36277225 tcttagaaatcgtggttgggactaacacaaccccacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcttgtc 36277324  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
36277325 cgatgtgagactcttaacac 36277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 21861379 - 21861261
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |||||||||||||||||||||||||| |||| ||    
21861379 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtaaggtgaggattgccctcacttataaacacattgtcaggccatgtcctgtc 21861280  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
21861279 cgatgtgggactcttaaca 21861261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 29469923 - 29469806
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||||||||||||| |||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| ||||    
29469923 ttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccg 29469824  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
29469823 atgtgggactcttaacac 29469806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 34027476 - 34027359
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||    
34027476 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccg 34027377  T
239 atgtgtgactcttaacac 256  Q
    ||||| || |||||||||    
34027376 atgtgggattcttaacac 34027359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 43688157 - 43688277
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||||||||||||||||||||||  ||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |||||    
43688157 attcttagaaatcgtggttgggcctaacacaaccccacaaac-cggcttgagaggtaaggattgcccccacttataaacacattgtcaggccatgtccta 43688255  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
43688256 tccgatgtgggactcttaacac 43688277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 26562074 - 26562191
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||||||||||| |||||||| |||||||||||| ||||||||||||||| | ||||||||||||||||||| |||||||||||| |||||| |||    
26562074 ttagaaatggtggttgagcctaacataaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcaggccaactcctaaccg 26562173  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
26562174 atgtgagactcttaacac 26562191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 26239915 - 26240034
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||||||||| | || |||||||||||||| |||||||||||||||||||||||||||| |||| |||||||    
26239915 tcttagaaattgtggttgggtctaacacaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatc 26240014  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  ||||||||||||    
26240015 cgatgtcggactcttaacac 26240034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 140 - 254
Target Start/End: Original strand, 44874348 - 44874462
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| |||||||||||||||||||||  |||||||||| ||||||||||||| || ||||||||||||||||||||||||||  |||||||||||||    
44874348 tagaaatcgtggttgggcctaacacaaccatacaaaatcggtttgtgaggtgaggatttcccccacttataaacacattgtcaggttatctcctatccga 44874447  T
240 tgtgtgactcttaac 254  Q
    |||| ||||||||||    
44874448 tgtgggactcttaac 44874462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 137 - 258
Target Start/End: Complemental strand, 6634940 - 6634819
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||||||||||||||||||||||||   |||| |||||||||| ||||||||||||||||||| |||||||||||| |||||| |    
6634940 tcttagaaatcatggttgggcctaacacaaccccacaaaactagcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaac 6634841  T
237 cgatgtgtgactcttaacaccg 258  Q
    ||||||| ||||||||||||||    
6634840 cgatgtgagactcttaacaccg 6634819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 48243059 - 48243177
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||  || |||    
48243059 ttcttacaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagacca--tcatat 48243156  T
236 ccgatgtgtgactcttaacac 256  Q
    | |||||| ||||||||||||    
48243157 ctgatgtgggactcttaacac 48243177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 2544452 - 2544564
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||| ||    
2544452 aaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgacgt 2544551  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
2544552 gggactcttaaca 2544564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 34027713 - 34027593
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||| ||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||| |||||||||||| || |||     
34027713 ttcttagaaatcgtgattgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaacaaattgtcaggccaacttctaa 34027614  T
236 ccgatgtgtgactcttaacac 256  Q
    | |||||| ||||||||||||    
34027613 ctgatgtgggactcttaacac 34027593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 1596913 - 1596794
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||| ||| |||||||||||||||||||||| |||||| |||||||| |||||||| ||||||||||||||||| ||||||| ||||||| |||| ||    
1596913 tcttagtaattgtggttgggcctaacacaaccctacaaaaccggcttgtaaggtgaggattgcccccacttataaaaacattgttaggccatgtcctgtc 1596814  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
1596813 cgatgtgggactcttaacac 1596794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 224
Target Start/End: Complemental strand, 25620221 - 25620134
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg 224  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||    
25620221 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagg 25620134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 1596678 - 1596561
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||  |||||||| |||||||| |||||||||||||| |||||||||||||||||| |||| ||    
1596678 tcttagaaattgtggttaggcctaacacaaccccacaaac-cggcttgtaaggtgaggattgcccccacttattaacacattgtcaggccatgtcctgtc 1596580  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
1596579 cgatgtgggactcttaaca 1596561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 3038083 - 3038201
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||| || | ||||| |||     
3038083 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaacacattgttagacaatctcttatt 3038182  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
3038183 cgatgtgggactcttaaca 3038201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 143 - 255
Target Start/End: Complemental strand, 17202258 - 17202146
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||| ||||  ||||||||||||||||||| |||||||||||| ||| || |||||||    
17202258 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgagaattgcccccacttataaacaaattgtcaggccaactcttaaccgatgt 17202159  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
17202158 gggactcttaaca 17202146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 137 - 253
Target Start/End: Original strand, 33996310 - 33996426
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||| |||||||| || |||||||||||| | ||||||||||||||||| ||||| | ||||||| |||||||    
33996310 tcttagaaatcgtggttgggcctaacacaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaatacattattaggccatgtcctatc 33996409  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
33996410 cgatgtgggactcttaa 33996426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 139 - 243
Target Start/End: Complemental strand, 40746348 - 40746244
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||| |||||||||||| |||||| ||     
40746348 ttagaaattgtggttgggcctaacacaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaacca 40746249  T
239 atgtg 243  Q
    |||||    
40746248 atgtg 40746244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 48661556 - 48661672
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||| ||||||||| | ||||||| ||||||||||||||||| |||||||||| |||||| ||||||||||| ||||||||||| |    
48661556 ttagaaatcgtggttgggtctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacctataaatacattgtcaggtcatctcctatctg 48661655  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
48661656 atgtgggactcttaaca 48661672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 2404173 - 2404292
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||   |||| || |||||| ||| ||| |||||||||||||||||||||||||||| |||||||||| |    
2404173 tcttagaaattgtggttgggcctaacacaacccttaaaaaccgacttgtggggttaggattgcccccacttataaacacattgtcagtccatctcctaac 2404272  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
2404273 cgatgtgggactcttaacac 2404292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 18826487 - 18826606
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||  |||||||||||||||||||||| ||||||||| ||||  || |||||||||||||||||||||||||| |||||||||||    
18826487 tcttagaaattatggttgaacctaacacaaccccacaaaatcagcttgtgagttgagaattacccccacttataaacacattgtcaggtcatctcctatc 18826586  T
237 cgatgtgtgactcttaacac 256  Q
    | ||||| ||||||||||||    
18826587 caatgtgggactcttaacac 18826606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 31892474 - 31892353
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| | ||| ||||||||||||| ||||||||| | ||| | | |    
31892474 attcttagaaatcgtggttgggcctaacacatccccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtcatgtcatgttcca 31892375  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
31892374 tccgatgtgagactcttaacac 31892353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 21821891 - 21821775
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| ||||||| ||| | |||||||||||||| |||| |||||||||||||||| ||||    
21821891 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcggtttgtgagatgaagattgcccccacttattaacatattgtcaggccatctcatatc 21821792  T
237 cgatgtgtgactcttaa 253  Q
     |||||| || ||||||    
21821791 tgatgtgagagtcttaa 21821775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 40746032 - 40746151
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||| ||||||||||||| ||||||||||| | ||| |||  |||||||||||||||||  ||||| |||||||    
40746032 tcttagaaattgtggttgggtctaacacaatcccacaaaatcggtttgtgaggtgaagattgtcccttcttataaacacattgtctagccatgtcctatc 40746131  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
40746132 cgatgtgggactcttaacac 40746151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 143 - 257
Target Start/End: Original strand, 2544220 - 2544334
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||| |||||||||||||||||||||||  ||||||| |||||| | ||||||||||||||||||| |||||||| ||| |||||| |||||||    
2544220 aaatcgtggtagggcctaacacaaccccacaaaactggcttgtaaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgt 2544319  T
243 gtgactcttaacacc 257  Q
    | |||||||||||||    
2544320 gggactcttaacacc 2544334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 138 - 256
Target Start/End: Original strand, 6001435 - 6001553
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||| |||| |||||||||  ||||| ||||| |||||||||| || |||||||||| ||||||||||||||||||| ||||||||| ||||| ||||||    
6001435 cttaaaaatcgtggttgggtttaacataaccctacaaaatcggtttctgaggtgaggattgcccccacttataaacatattgtcaggtcatcttctatcc 6001534  T
238 gatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||    
6001535 gatgtgggactcttaacac 6001553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 42985122 - 42985240
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||| | ||||||||||| |||||||||| |||||||||||||| ||||| |||||||||||||||||||||  ||||| | ||||    
42985122 tcttagaaattatggttgagtctaacacaacctcacaaaatcgacttgtgaggtgaggattgcctccacttataaacacattgtcaaaccatcacatatc 42985221  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
42985222 cgatgtgagactcttaaca 42985240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 149 - 255
Target Start/End: Original strand, 48243448 - 48243554
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||| ||||||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||||||||||| | ||| | ||||| ||||    
48243448 tggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattgcccccacttataaacacattgtcaggccatcacatattcaatgtgggact 48243547  T
249 cttaaca 255  Q
    |||||||    
48243548 cttaaca 48243554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 137 - 249
Target Start/End: Original strand, 32879613 - 32879726
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||| | || |||||||||||||||||||| ||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||     
32879613 tcttagaagtcgtcgttgggcctaacacaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccatctcttaa 32879712  T
236 ccgatgtgtgactc 249  Q
    |||| ||| |||||    
32879713 ccgaagtgggactc 32879726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 40746581 - 40746464
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  |||||||||||||||||||| |||||||  ||||||||||||| || || |||||||||||||||| |||||||||||| |||||| ||     
40746581 ttagaaatcatggttgggcctaacacaacctcacaaaactggcttgtgaggtgtggatttcccccacttataaacaaattgtcaggccaactcctaacca 40746482  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
40746481 atgtgggactcttaacac 40746464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 4268140 - 4268020
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatc-ggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||  ||||||||||||||||||||||| |||| | ||||| |||||||| | ||||||||||||||||||| |||||||||||| ||||||     
4268140 tcttagaaatcttggttgggcctaacacaaccccaaaaaaaccggcttttgaggtgatgattgcccccacttataaacaaattgtcaggccaactcctaa 4268041  T
236 ccgatgtgtgactcttaacac 256  Q
    | |||||| ||||||||||||    
4268040 ctgatgtgggactcttaacac 4268020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 143 - 251
Target Start/End: Original strand, 11211684 - 11211791
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| ||| ||||||||||||| ||||||| |||||||||| ||||||| ||    
11211684 aaatcgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaagacattgttaggccatctcttatccgacgt 11211782  T
243 gtgactctt 251  Q
    | |||||||    
11211783 gggactctt 11211791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 31257268 - 31257384
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||  | ||| ||||||||||||||||| | |||||||| ||| |||||| |||    
31257268 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaattaaggattgcccccacttataaataaattgtcagaccaactcctaaccg 31257367  T
239 atgtgtgactcttaaca 255  Q
    ||||| ||| |||||||    
31257368 atgtgagacgcttaaca 31257384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 141 - 256
Target Start/End: Original strand, 3519733 - 3519843
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| ||||||| |||||||||| |||||||||| ||||||||||||      || ||||||||||||||||||||||||||||||| ||||||||||    
3519733 agaaatcgtggttgagcctaacacagccccacaaaaccggcttgtgagga-----ttacccccacttataaacacattgtcaggccatcacctatccgat 3519827  T
241 gtgtgactcttaacac 256  Q
    ||| ||||||||||||    
3519828 gtgggactcttaacac 3519843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 22574920 - 22574802
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| | ||||||  ||||||||||||||||| |||||| |||||||||| ||||||||| | |||| | ||||    
22574920 tcttagaaatcgtggttgggcctaacacaaactcacaaatacggcttgtgaggtgaggattgccctcacttataaa-acattgtcatgtcatcacatatc 22574822  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
22574821 cgatgtgagactcttaacac 22574802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 36993073 - 36993192
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| | ||||||||||||||  |||| || |||||||||||||||||||| |||| || ||||    
36993073 tcttagaaatcatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagcattgctcctacttataaacacattgtcagaccatgtcatatc 36993172  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||   |||||||||||    
36993173 cgatgttgaactcttaacac 36993192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 10903168 - 10903051
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||| ||| ||||||||| |||||||||| |||||||| ||||||||||||||||| || |||| ||||||||||| ||||||| ||||| |||||| ||    
10903168 ttagtaatcgtggttggggctaacacaactccacaaaaccggcttgtgaggtgaggattacccctacttataaacatattgtcaagccatgtcctattcg 10903069  T
239 atgtgt-gactcttaaca 255  Q
    |||||| |||||||||||    
10903068 atgtgtggactcttaaca 10903051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 142 - 243
Target Start/End: Original strand, 32278889 - 32278990
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    ||||||||||||| ||||||||||||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||||||| ||||| | |||||||||    
32278889 gaaatggtggttgagcctaacacaacctcacaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatcacatatccgatg 32278988  T
242 tg 243  Q
    ||    
32278989 tg 32278990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 137 - 229
Target Start/End: Original strand, 31485658 - 31485750
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    |||||||||| |||||| |||||||||||||  ||||||| |||||||| |||||||| ||||||||||||||||| ||||||||||||||||    
31485658 tcttagaaattgtggttaggcctaacacaacttcacaaaaccggcttgtcaggtgaggattgcccccacttataaaaacattgtcaggccatc 31485750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 36206064 - 36206180
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| |||||| ||||||||| |||| ||||||||||||||| | ||||| ||||||||||||| ||||| |||||| |||||| |||    
36206064 ttagaaatcgtggttgagcctaatacaaccccataaaaccggcttgtgaggtgaagattgcctccacttataaacaaattgttaggccaactcctaaccg 36206163  T
239 atgtgtgactcttaaca 255  Q
    |||||  ||||||||||    
36206164 atgtggaactcttaaca 36206180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 140 - 251
Target Start/End: Original strand, 23839079 - 23839190
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| || | |||||||||||||||| ||||||| ||||||||||||||||| || |||||||||||||||| ||||| || ||||||| ||||||     
23839079 tagaaattgtcgatgggcctaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacagattgttagaccatctcttatccgt 23839178  T
240 tgtgtgactctt 251  Q
    |||| |||||||    
23839179 tgtgagactctt 23839190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 152 - 255
Target Start/End: Complemental strand, 31892221 - 31892118
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||| ||| |||||||| ||||||||||||||||| ||| ||||||||||||| ||||||||| || || |||||||||||||| |||| ||    
31892221 ttgggcctaacataactccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcatgctatatcctatccgatgtgggactttt 31892122  T
252 aaca 255  Q
    ||||    
31892121 aaca 31892118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 2404407 - 2404525
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| || ||||||| ||| | |||| || |||||| ||||||| ||||||| |||||||||||||||||||| || |||||||||    
2404407 tcttagaaatcgtggttgagcttaacacagccctataaaaccgacttgtggggtgaggattgcccctacttataaacacattgtcagtccgtctcctatc 2404506  T
237 cgatgtgtgactcttaaca 255  Q
    ||| ||| |||||||||||    
2404507 cgacgtgggactcttaaca 2404525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 139 - 233
Target Start/End: Original strand, 10882007 - 10882100
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||||||| |||||||||||||| | |||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||| |||||    
10882007 ttagaaatcgtggttgggcctaata-aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcct 10882100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 139 - 253
Target Start/End: Original strand, 31257032 - 31257146
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| | |||||||||||||||||||  || ||||||||||| | ||||||||||||||||||| |||||||| ||| || ||| |||    
31257032 ttagaaatcgtggttgagtctaacacaaccccacaaaactggtttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaacttctaaccg 31257131  T
239 atgtgtgactcttaa 253  Q
    ||||| |||||||||    
31257132 atgtgagactcttaa 31257146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 5522966 - 5522846
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaat--cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||| |||| |||||||||| |||||||||| ||||||||  ||||||||||||||| | |||| |||||||| |||||||||||||| ||| ||| ||    
5522966 tcttaaaaatcgtggttgggcgtaacacaacctcacaaaataccggcttgtgaggtgaagattgctcccacttaaaaacacattgtcagaccaactctta 5522867  T
235 tccgatgtgtgactcttaaca 255  Q
    | ||||||| |||||||||||    
5522866 tacgatgtgggactcttaaca 5522846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 134 - 243
Target Start/End: Complemental strand, 15317640 - 15317532
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||||||||||||  ||||||||||||||||||| ||||||||   | ||||||||||||| ||||||||||||||||||||| |||||||||||||  |    
15317640 gattcttagaaattatggttgggcctaacacaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaacaca-tgtcaggccatctttt 15317542  T
234 atccgatgtg 243  Q
    |||| |||||    
15317541 atccaatgtg 15317532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 149 - 254
Target Start/End: Original strand, 26028972 - 26029077
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||| ||||||||||| ||||||||||||||||||||||||| |||| |||| ||| ||| | |||||||||||| |||||| |||||||  ||||    
26028972 tggttgggtctaacacaacctcacaaaatcggcttgtgaggtgaggattgctcccatttaaaaataaattgtcaggccaactcctaaccgatgtaggact 26029071  T
249 cttaac 254  Q
    ||||||    
26029072 cttaac 26029077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 155 - 256
Target Start/End: Original strand, 31485441 - 31485542
Alignment:
155 ggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    |||||||||||||| ||||||| | | |||||| |||||| |||||||||||||||||||||||||||||||||| | ||||  ||||| ||||||||||    
31485441 ggcctaacacaacctcacaaaaccagtttgtgatgtgaggattgcccccacttataaacacattgtcaggccatcacatatcttatgtgggactcttaac 31485540  T
255 ac 256  Q
    ||    
31485541 ac 31485542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 43085534 - 43085655
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc-tcct 233  Q
    |||||||||||| ||||||| || |||||||||||||||||| |  |||||||||||||| |||||||||||||||||||| |||||| | |||| | |     
43085534 attcttagaaatcgtggttgagcttaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcatctttca 43085633  T
234 atccgatgtgtgactcttaaca 255  Q
     ||||||||| |||||||||||    
43085634 ttccgatgtgagactcttaaca 43085655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 241
Target Start/End: Complemental strand, 4886414 - 4886310
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||| | | ||| ||||||||||||||||| ||||||||| | ||||||| ||||||||||||| || | ||    
4886414 tcttagaaatcgtggttgggcctaacacaacctcgccaaaccggcttgtgaggtgaggattgcccccattaataaacatattgtcaggccatgtcatgtc 4886315  T
237 cgatg 241  Q
    |||||    
4886314 cgatg 4886310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 1793831 - 1793719
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||| ||||| ||||||||||||  ||||||||||||||| | ||||||||||||||| ||||||||||| ||||  |||||||||| ||||||| ||||    
1793831 tcttcgaaatcgtggttgggccttgcacaaccccacaaaacctgcttgtgaggtgaggattgcccccactaataa--acattgtcagaccatctcttatc 1793734  T
237 cgatgtgtgactctt 251  Q
    | ||||| |||||||    
1793733 caatgtgagactctt 1793719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 141 - 243
Target Start/End: Original strand, 3520042 - 3520145
Alignment:
141 agaaatggtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    |||||| |||||||  |||||||||||||  | |||| ||||||| ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||    
3520042 agaaatcgtggttgaacctaacacaacccttataaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccga 3520141  T
240 tgtg 243  Q
    ||||    
3520142 tgtg 3520145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 14540740 - 14540859
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||   ||||||||||  ||| ||||| ||||||||| | |||| ||| ||  ||||||||||||||||||||| |||||||||||    
14540740 tcttagaaatcgtggttaaacctaacacaattccaaaaaattggcttgtgatgagaggattgtccttacttataaacacattgtcaggtcatctcctatc 14540839  T
237 cgatgtgtgactcttaacac 256  Q
    |||||||||| |||||||||    
14540840 cgatgtgtgattcttaacac 14540859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 139 - 250
Target Start/End: Original strand, 20305664 - 20305775
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||| |||||||||||||||||||||||  | ||||||||||||| ||||||||||||||||||||||| |  |  ||||||||||||     
20305664 ttagaaatcatggttaggcctaacacaaccccacaaaataagtttgtgaggtgaggattgcccccacttataaacacattattggaacatctcctatcca 20305763  T
239 atgtgtgactct 250  Q
    ||||| ||||||    
20305764 atgtgggactct 20305775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 21822129 - 21822005
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc----acttataaacacattgtcaggccatctc 231  Q
    ||||||||||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| ||||||||    | ||||||||||||||| | ||||||||    
21822129 ttcttagaaattgtggttgggtctaacacaaacccacaaaatctgcttgtgagatgaggattgcccccttataattataaacacattgtgacgccatctc 21822030  T
232 ctatccgatgtgtgactcttaacac 256  Q
     |||||||||||  ||| |||||||    
21822029 atatccgatgtggaactgttaacac 21822005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 135 - 254
Target Start/End: Original strand, 33996076 - 33996195
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||| |||| |||||||  ||||| ||||| ||| ||||| |||||||||||||||| ||| |||||| ||||||||||||||||| | || || ||    
33996076 attcttaaaaatcgtggttgaacctaatacaactccataaaatgggcttgtgaggtgaggattgtccccacgtataaacacattgtcagacaatgtctta 33996175  T
235 tccgatgtgtgactcttaac 254  Q
    ||||||||| ||||||||||    
33996176 tccgatgtgggactcttaac 33996195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 28080749 - 28080632
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||  |||||| |||||||||||| || ||||||| ||||   ||||||  ||||||||||||||||||||| |||||| ||||    
28080749 tcttagaaatcgtggttggatctaacataaccccacaaaaccgacttgtgaagtgaaaattgccct-acttataaacacattgtcaggtcatctcttatc 28080651  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
28080650 cgatgtgagactcttaaca 28080632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 149 - 242
Target Start/End: Original strand, 23796195 - 23796288
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||| |||||||||||||||||||||||   ||||||||||| | ||||||||||||||||||||||||| || ||||||  ||||||||||    
23796195 tggttgagcctaacacaaccccacaaaatcaatttgtgaggtgatgattgcccccacttataaacacattgttagaccatcttttatccgatgt 23796288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 43075307 - 43075428
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc-tcct 233  Q
    |||||||||||| ||||||| ||  ||||||||||||||||| |  |||||||||||||| |||||||||||||||||||| |||||| | |||| | |     
43075307 attcttagaaatcgtggttgagctcaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcatctttca 43075406  T
234 atccgatgtgtgactcttaaca 255  Q
     ||||||||| |||||||||||    
43075407 ttccgatgtgagactcttaaca 43075428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 159 - 255
Target Start/End: Complemental strand, 46452696 - 46452599
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgccccc-acttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||| |  |||||||||||||| |||||||| |||||||||||||||||  || ||| |||||||||||||| |||||||||||    
46452696 taacacaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaaca 46452599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 9689123 - 9689207
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||| ||||||||||||||||| || ||||||||||||| ||||||||||  ||||| ||||||||||||| |||||||||||    
9689123 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 9689207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 136 - 207
Target Start/End: Complemental strand, 32474586 - 32474515
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    ||||||||||| ||||||||||||||| ||| ||||||||| ||||||||||||||||| ||||||||||||    
32474586 ttcttagaaattgtggttgggcctaacgcaaacccacaaaaccggcttgtgaggtgaggattgcccccactt 32474515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 36276990 - 36277109
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||| |||| |||| | ||||||||||||||  ||| |||||||||||||||||||||||| | ||  | | ||    
36276990 tcttagaaatcgtggttaggcctaacacaatcccataaaacctgcttgtgaggtgagaattgtccccacttataaacacattgtcagactatgccatgtc 36277089  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
36277090 tgatgtgagactcttaacac 36277109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 148 - 243
Target Start/End: Complemental strand, 47849645 - 47849550
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    ||||||| ||||||||||| ||||||||| ||| ||||||||||||| ||||||| ||||||||||||||  ||| |||||||  |||||||||||    
47849645 gtggttgagcctaacacaagcccacaaaaccgggttgtgaggtgaggattgccccaacttataaacacatgttcatgccatcttttatccgatgtg 47849550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 4267941 - 4267820
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcg--gcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||| |||| ||||||||||||||||||| || | ||||     |||| |||||||||| ||||||||||||||||||| |||||||| ||| ||||||    
4267941 tcttaaaaatcgtggttgggcctaacacaatccaaaaaaaaactagcttttgaggtgaggattgcccccacttataaacaaattgtcagaccaactccta 4267842  T
235 tccgatgtgtgactcttaacac 256  Q
     |||||||| ||||||||||||    
4267841 accgatgtgggactcttaacac 4267820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 14540957 - 14541068
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||| |||||||||||||||||||||||||||| || ||| ||||||| || |||||||||||||| |||  ||||||| | ||| || ||| ||||||    
14540957 aaatgatggttgggcctaacacaaccccacaaaaccgacttatgaggtgtggattgcccccacttat-aacgtattgtcaagtcatttcatattcgatgt 14541055  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
14541056 gagactcttaaca 14541068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 30727115 - 30727195
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||||||| |||||||||||||||  ||||  |||||| | ||||||||||||||| ||||||||||||||||||||    
30727115 attcttagaaattgtggttgggcctaacttaaccgtacaaaaccagcttgtgaggtgaggattgcccccacttataaacac 30727195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 40898714 - 40898794
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||| |||| |||||||| || |||||||| |||||||||||| |||| |||||||| ||||||||||||||||||||||    
40898714 tcttaaaaattgtggttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 40898794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 153 - 256
Target Start/End: Complemental strand, 25620440 - 25620337
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctta 252  Q
    ||||| |||||||| || |||||| | |||||||||||| || ||||||| |||||||| |||||||||||| ||| ||||||| |||||  ||||||||    
25620440 tgggcttaacacaatcctacaaaacctgcttgtgaggtggggattgcccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactctta 25620341  T
253 acac 256  Q
    ||||    
25620340 acac 25620337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 32292591 - 32292489
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat-ctcctatccgatgtgtgac 247  Q
    |||||||||||| ||||||||||||||  |||||||||||||||||   |||||||||||||||||| |  ||||||||| ||| ||||||||||| |||    
32292591 tggttgggccta-cacaaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaacacttgttcaggccatactcttatccgatgtgagac 32292493  T
248 tctt 251  Q
    ||||    
32292492 tctt 32292489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 165 - 256
Target Start/End: Original strand, 35308173 - 35308264
Alignment:
165 aaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||| |||||| ||  ||||||||||| | ||||||||||||||||||||||||||| | ||||||||||| |||||| || |||||||||    
35308173 aaccctacaaaaccgaattgtgaggtgatgattgcccccacttataaacacattgtcatgacatctcctatctgatgtgagattcttaacac 35308264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 1000634 - 1000560
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||||| ||||||||||| || |||||||||||||| || ||||| |||||||| ||||||||||||||||    
1000634 tcttagaaatcgtggttgggccaaagacaaccccacaaaaccgtcttgtaaggtgaggattgcccccacttataa 1000560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 1794003 - 1793921
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtc 221  Q
    |||||||| ||||||||||| ||||||||| |||||||  |||||||||||||||| || || ||||||| ||||||||||||    
1794003 ttagaaatcgtggttgggcccaacacaaccgcacaaaactggcttgtgaggtgaggttttcctccacttacaaacacattgtc 1793921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 149 - 243
Target Start/End: Original strand, 23796034 - 23796127
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    |||||| |||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||| | ||||||| ||||||  | |||||||||    
23796034 tggttgagcctaacacatccccataaaatcggcttgtgaggtgaggattg-ccccacttataaacccgttgtcagaccatcttttgtccgatgtg 23796127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 2401439 - 2401339
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||| ||||||||||| | |||||||||| ||||||| |||| | ||| || ||||||||||||||||||||| ||  ||| ||||||||||    
2401439 aaatcgtggttgagcctaacacaatctcacaaaatcgacttgtgaagtgaagattgtccacacttataaacacattgtcagaccgcctcttatccgatgt 2401340  T
243 g 243  Q
    |    
2401339 g 2401339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 135 - 255
Target Start/End: Complemental strand, 41191101 - 41190981
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||  ||| |||| |||||||||| | ||||||| |||||||||| |||||| |||| | |||||||||||| ||||||||   ||| | ||    
41191101 attcttagaaactgtgattggacctaacacaatctcacaaaaccggcttgtgatgtgaggattgctctcacttataaacatattgtcagattatcacata 41191002  T
235 tccgatgtgtgactcttaaca 255  Q
    || |||||| |||||||||||    
41191001 tctgatgtgggactcttaaca 41190981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 255
Target Start/End: Original strand, 43089230 - 43089326
Alignment:
160 aacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc-tcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||| |  |||||||||||||| |||||||||||||||||||| |||||| | |||| | |  ||||||||| |||||||||||    
43089230 aacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtcatgtcatctttcattccgatgtgagactcttaaca 43089326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 47849864 - 47849763
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||||||||| |||||||||||||||  |||||||||||||||  ||||||| |||||||||||| |  ||| | |||||  ||||||||||| |||    
47849864 gtggttgggcctagcacaaccccacaaaactggcttgtgaggtgagtattgccccaacttataaacacgt--tcatgtcatcttttatccgatgtgggac 47849767  T
248 tctt 251  Q
    ||||    
47849766 tctt 47849763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 4454827 - 4454768
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    |||||| ||| ||||||||||||| |||||||||||||||||||||||||||| ||||||    
4454827 acaaaaccggtttgtgaggtgaggattgcccccacttataaacacattgtcagaccatct 4454768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 141 - 256
Target Start/End: Complemental strand, 4507246 - 4507131
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| ||||| ||| ||||||||| || |||||| | |||||||| |||| | ||| ||||||||||||||| |||  ||||||||||  |||| |||    
4507246 agaaattgtggtcgggtctaacacaatcctacaaaaccagcttgtgaagtgaagattgtccccacttataaacatattagcaggccatcttgtatctgat 4507147  T
241 gtgtgactcttaacac 256  Q
    ||| ||||||||||||    
4507146 gtgagactcttaacac 4507131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 168 - 255
Target Start/End: Complemental strand, 22574659 - 22574572
Alignment:
168 cccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||| ||||||||||||||||  |||| | |||||||||||| ||| ||| |||||| | ||||||||||| |||||||||||    
22574659 cccacaaaaccggcttgtgaggtgagaattgctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaaca 22574572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 150 - 254
Target Start/End: Complemental strand, 33834490 - 33834394
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    ||||||| ||||||||| ||||||||| ||||||||||||||| | ||||||||        |||||||||||| ||||| ||||||||||||| |||||    
33834490 ggttgggtctaacacaaacccacaaaaccggcttgtgaggtgaagattgccccc--------acacattgtcagaccatcacctatccgatgtgggactc 33834399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 48417518 - 48417609
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    |||||| |||||||||||||||||||||||||||||  || ||||||||| | | |||| | ||||||||||||| |  |||||||||||||    
48417518 agaaattgtggttgggcctaacacaaccccacaaaactggtttgtgaggtcaagattgctctcacttataaacacttgttcaggccatctcc 48417609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 136 - 214
Target Start/End: Original strand, 23794354 - 23794432
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||| |||| ||||||| ||||||| ||| |||||||||| |||||||||||||||| ||||| ||| |||||||||    
23794354 ttcttaaaaatcgtggttgagcctaactcaatcccacaaaattggcttgtgaggtgaggattgccaccatttataaaca 23794432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 243
Target Start/End: Original strand, 25886805 - 25886911
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||| |||||||||||| |||||||||  || |||||| |  ||||| |||| ||||||||| |||||||   |||||||||||    
25886805 tcttaaaaatagtggttgggtctaacacaaccctacaaaatcgatttatgaggtaaatgttgctcccatttataaacatattgtcatatcatctcctatc 25886904  T
237 cgatgtg 243  Q
    |||||||    
25886905 cgatgtg 25886911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 222
Target Start/End: Complemental strand, 4507017 - 4506932
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    |||||||||| || |||||| |||||||||||||| |||| || |||||||||||||| ||||  | || ||||||||||||||||    
4507017 tcttagaaatcgtagttgggtctaacacaaccccataaaaccgacttgtgaggtgaggattgctgcaacgtataaacacattgtca 4506932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 6782944 - 6782883
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcc 200  Q
    |||||||| ||||||| ||||||||||||||||||||| |||||||| |||||||| |||||    
6782944 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcc 6782883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 136 - 257
Target Start/End: Original strand, 9688868 - 9688989
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||||||  ||||||||  |||||||| |||| |||| | || |||||||||||| ||||  ||||| ||||| ||| |||||| |||||  ||||    
9688868 ttcttagaaatcctggttgggtttaacacaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctat 9688967  T
236 ccgatgtgtgactcttaacacc 257  Q
    ||||||||  ||||||||||||    
9688968 ccgatgtggaactcttaacacc 9688989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 40121923 - 40121980
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||  |||||||    
40121923 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtagggtgagg 40121980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 6991840 - 6991756
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtc 221  Q
    |||||||||| ||||||||||||||||||||| || ||||  |||||  ||||||||| ||| | ||||||||||||| ||||||    
6991840 tcttagaaattgtggttgggcctaacacaacctcataaaactggcttaagaggtgaggattgtcgccacttataaacaaattgtc 6991756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 27939244 - 27939160
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||| |||||||| |||||||||||||||| |||||||||  ||||||| | ||||||||||||| |||   |||||||||||    
27939244 ttgggcataacacaatcccacaaaatcggcttatgaggtgagtattgcccctatttataaacacattttcaactcatctcctatc 27939160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 32279071 - 32279151
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||||||||||||| ||||||| | | ||||||  ||||||| |||||||| ||| || |||||||||||||||||||||    
32279071 aaatggtggttgggcataacacagctctacaaaactggcttgttaggtgaggattgtccacacttataaacacattgtcag 32279151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 40898921 - 40899001
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| | ||| ||| ||||||||||| |||| |||| | ||||||||||||| | ||||||||||||||||||||||    
40898921 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat 40899001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 25507445 - 25507508
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||| |||||||||||||||||||| ||||||||||| ||||  ||||||||||| |||||||    
25507445 ttgggtctaacacaaccccacaaaattggcttgtgaggcgaggactgcccccacttgtaaacac 25507508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 176
Target Start/End: Complemental strand, 33834276 - 33834237
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    ||||||||||||||||||||||||||||||||||||||||    
33834276 tcttagaaatggtggttgggcctaacacaaccccacaaaa 33834237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 143 - 237
Target Start/End: Complemental strand, 8075938 - 8075844
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||| |||||||| ||| ||||||| ||| |||| || |||||||||||| | ||  ||||||||||||||||||| ||| ||||||| ||||||    
8075938 aaatcgtggttggacctgacacaactccataaaaccgacttgtgaggtgaagattatccccacttataaacacattatcatgccatcttctatcc 8075844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 139 - 252
Target Start/End: Original strand, 2315271 - 2315384
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||| ||| | |||| |||||||||||||| |||||| |||||||||  ||||| |||| |||||| |||| ||||| ||||| | ||| ||    
2315271 ttagaaatcgtgattgagtctaagacaaccccacaaaaccggcttatgaggtgagaattgcctccacatataaatacatagtcagaccatcacatattcg 2315370  T
239 atgtgtgactctta 252  Q
    ||||| || |||||    
2315371 atgtgggattctta 2315384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 148 - 252
Target Start/End: Complemental strand, 9625487 - 9625383
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    |||||||| | |||| ||||||| ||||| |  |||||||||||||| ||  ||||||||||||| | |||||||| ||||| ||||||| |||||  ||    
9625487 gtggttggtcttaactcaaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaac 9625388  T
248 tctta 252  Q
    |||||    
9625387 tctta 9625383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 171 - 222
Target Start/End: Original strand, 40792830 - 40792881
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    ||||||||||||||||||||||||  | || |||||||||||||||||||||    
40792830 acaaaatcggcttgtgaggtgaggactaccgccacttataaacacattgtca 40792881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 49117327 - 49117224
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||| |||||||| | ||||| |||| |||||||||||||||||  ||||| ||||||||||||  |   ||||||||| | ||||| ||||| |||    
49117327 gtggttgagcctaacatagccccagaaaagcggcttgtgaggtgaggactgccctcacttataaacatctatccaggccatcacttatccaatgtgggac 49117228  T
248 tctt 251  Q
    ||||    
49117227 tctt 49117224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 150 - 256
Target Start/End: Complemental strand, 33515771 - 33515665
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    ||||| ||||||| |||| | | |||| ||||||||  || ||||  |||||||||||||||||||||| ||||||| | ||  |||| ||||| |||||    
33515771 ggttgagcctaactcaacactagaaaaacggcttgttcggcgaggactgcccccacttataaacacattatcaggccttatctcatccaatgtgggactc 33515672  T
250 ttaacac 256  Q
    |||||||    
33515671 ttaacac 33515665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 10882238 - 10882275
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaa 174  Q
    |||||||||| |||||||||||||||||||||||||||    
10882238 tcttagaaatcgtggttgggcctaacacaaccccacaa 10882275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 5871955 - 5872033
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| ||||||||| ||| ||| |||| ||||||||||||||||| ||| || ||| ||||||||| ||||||||    
5871955 tcttagaaatcgtggttgggacta-cactaccctacaaaatcggcttgtgaagtggggattg-ccccacttaaaaacacat 5872033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 21473090 - 21473142
Alignment:
163 acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||| |||||||| || ||||||||||||| |||| |||||||||||||||    
21473090 acaacctcacaaaattggtttgtgaggtgaggattgctcccacttataaacac 21473142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 216
Target Start/End: Original strand, 44874577 - 44874657
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacaca 216  Q
    ||||||| || |||||| |||||||||||| |||| |||||||||||||  ||||||| ||| || |||| ||||||||||    
44874577 tcttagacattgtggtttggcctaacacaagcccataaaatcggcttgtagggtgaggattgtcctccacgtataaacaca 44874657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 176
Target Start/End: Original strand, 7786253 - 7786292
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    ||||||||||  ||||||||||||||||||||||||||||    
7786253 tcttagaaatcatggttgggcctaacacaaccccacaaaa 7786292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 155 - 243
Target Start/End: Complemental strand, 32292805 - 32292720
Alignment:
155 ggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt-caggccatctcctatccgatgtg 243  Q
    |||||||||||| ||||||||| |   |||||||||||||  ||||||||||||||||||| |||| || |||||| | |||||||||||    
32292805 ggcctaacacaaacccacaaaacc---ttgtgaggtgaggactgcccccacttataaacac-ttgtgcatgccatcacttatccgatgtg 32292720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 182
Target Start/End: Original strand, 48420739 - 48420786
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggct 182  Q
    |||||||||| | ||||||||||||| ||||||||||||||| |||||    
48420739 attcttagaattcgtggttgggcctagcacaaccccacaaaaccggct 48420786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 251
Target Start/End: Complemental strand, 4507852 - 4507733
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactta----taaacacattgtcaggccatctc 231  Q
    ||||||||||| ||||||||| || |||||||  || ||||  || |||| |||| ||| ||| |||||||||    |||||||||| |||| |||||||    
4507852 ttcttagaaattgtggttgggtcttacacaacttcaaaaaactggtttgtaaggtaaggattgtccccacttataattaaacacattatcagaccatctc 4507753  T
232 ctatccgatgtgtgactctt 251  Q
     ||||||||||  |||||||    
4507752 ttatccgatgtaggactctt 4507733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 231
Target Start/End: Original strand, 18825681 - 18825775
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    ||||| |||| ||||||| |  ||||| || ||||||||||||  || |||| ||||| ||| ||  ||||||||||||||||| ||||||||||    
18825681 tcttaaaaattgtggttgagtttaacataatcccacaaaatcgatttttgagttgaggattgtccatacttataaacacattgttaggccatctc 18825775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 139 - 217
Target Start/End: Original strand, 22339604 - 22339682
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| || ||||||||||||||||||  |  ||| ||||||||||||| ||| ||| ||| |||||| |||||||    
22339604 ttagaaattgtcgttgggcctaacacaacctaaataaaccggcttgtgaggttaggattgtcccaacttatgaacacat 22339682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 194
Target Start/End: Complemental strand, 24432208 - 24432150
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    ||||||||||| ||||||| | |||| |||||| ||||||||| ||||||||| |||||    
24432208 ttcttagaaattgtggttgagtctaatacaacctcacaaaatcagcttgtgagatgagg 24432150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 230
Target Start/End: Original strand, 1939027 - 1939099
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    |||||||||||||||||||||  | |||||  |||| | ||||| ||||||||||||||| |||||| ||||||    
1939027 cctaacacaaccccacaaaattagattgtgctgtgacgattgcctccacttataaacaca-tgtcagaccatct 1939099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 217
Target Start/End: Original strand, 21213059 - 21213120
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||||| |||||||| |  |||||||||||| | || | |||||||||||||||||    
21213059 gcctaacacaactccacaaaaccaacttgtgaggtgatgattactcccacttataaacacat 21213120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 5871576 - 5871628
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    |||||||| | ||||||| |||||| || ||||||||| ||||||||||||||    
5871576 ttagaaattgcggttgggtctaacaaaatcccacaaaaccggcttgtgaggtg 5871628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 220
Target Start/End: Original strand, 10221354 - 10221409
Alignment:
167 ccccacaaaatcggcttgtgag--gtgagggttgcccccacttataaacacattgt 220  Q
    |||||||||||||| |||||||  |||||| || ||| ||||||||||||||||||    
10221354 ccccacaaaatcggattgtgagatgtgaggattaccctcacttataaacacattgt 10221409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 40991754 - 40991818
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaa 212  Q
    ||||||| | ||||||||||| ||||||| | | ||||||| ||||| || ||||||||||||||    
40991754 gtggttgagtctaacacaacctcacaaaaccagattgtgagatgaggattacccccacttataaa 40991818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 96; Significance: 9e-47; HSPs: 117)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 41666756 - 41666875
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||    
41666756 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 41666855  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
41666856 cgatgtgggactcttaacac 41666875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 41666992 - 41667110
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||    
41666992 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 41667091  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
41667092 cgatgtgggactcttaaca 41667110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 9368679 - 9368562
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||||  |||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||    
9368679 cttagaaattatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcacgccatctcctatcc 9368580  T
238 gatgtgtgactcttaaca 255  Q
    ||||| ||||||||||||    
9368579 gatgtatgactcttaaca 9368562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 136 - 253
Target Start/End: Complemental strand, 9368916 - 9368799
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||  ||||||||||||||||||||||||||| ||||||||||||    
9368916 ttcttagaaattgtggttgggcctaacacaaccccacataatcggcttgtgaagtgagaattgcccccacttataaacacattgtcatgccatctcctat 9368817  T
236 ccgatgtgtgactcttaa 253  Q
    |||||||| |||||||||    
9368816 ccgatgtgggactcttaa 9368799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 18333462 - 18333583
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||    
18333462 attcttagaatttgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctccta 18333561  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| || |||||||||    
18333562 tccgatgtgggattcttaacac 18333583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 24346500 - 24346619
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||||| |||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||    
24346500 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcctatc 24346599  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
24346600 cgatgtgggactcttaacac 24346619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 27132994 - 27133111
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||| |||||||||||| |||||| |||    
27132994 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaaccg 27133093  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
27133094 atgtgagactcttaacac 27133111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 8081112 - 8081232
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccc-cacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||  |||||||||||||||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||||||||||||||||| ||||||    
8081112 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctat 8081211  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
8081212 ccgatgtgggactcttaacac 8081232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 149 - 256
Target Start/End: Original strand, 95277 - 95384
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||||||||||||||||||||||| ||||||||||| ||||| ||| ||||||||||||||||||||||||| |||| ||||||||||||||||||    
95277 tggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcaggtcatcacctatccgatgtgtgact 95376  T
249 cttaacac 256  Q
    ||||||||    
95377 cttaacac 95384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 137 - 249
Target Start/End: Complemental strand, 15480407 - 15480295
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||| |||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||    
15480407 tcttagaaatcgtggttgggcctaacagaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatc 15480308  T
237 cgatgtgtgactc 249  Q
    ||||||| |||||    
15480307 cgatgtgggactc 15480295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 19705988 - 19705869
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||| |||||||| |||||| | |||||||| |||||||||||||||||||||||||||||| || ||||| |    
19705988 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttataaggtgaggattgcccccacttataaacacattgtcaggctatgtcctacc 19705889  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
19705888 cgatgtgggactcttaacac 19705869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 24269870 - 24269988
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||||| |||| ||||||||||||||||| || |||| ||||||||||||||||||||||||| |||||||    
24269870 tcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggattacccc-acttataaacacattgtcaggccatgtcctatc 24269968  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
24269969 cgatgtgggactcttaacac 24269988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 24531684 - 24531581
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||| ||    
24531684 tcttagaaatcgtggttgggcataacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcctctc 24531585  T
237 cgat 240  Q
    ||||    
24531584 cgat 24531581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 2063733 - 2063850
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||||||||||||||||||||| |||| | |||||    
2063733 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgag-tgaggattgcccccacttataaacacattgtcagaccatgttctatc 2063831  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
2063832 cgatgtgggactcttaaca 2063850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 15480644 - 15480523
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg--cccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||  ||||||||||||||||| |||||||||||| || ||    
15480644 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcata 15480545  T
235 tccgatgtgtgactcttaacac 256  Q
    || |||||| ||||||||||||    
15480544 tctgatgtgggactcttaacac 15480523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 140 - 257
Target Start/End: Complemental strand, 24647778 - 24647661
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||| |||||||| ||||||||||| |||||||| ||||||||||||||||| ||||| ||| |||||||||||||||| ||||||| |||||||||    
24647778 tagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgccaccagttataaacacattgtccggccatcacctatccga 24647679  T
240 tgtgtgactcttaacacc 257  Q
    |||| |||||||||||||    
24647678 tgtgggactcttaacacc 24647661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 8098400 - 8098285
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||| |||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||| |||||| |||    
8098400 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacaaattgtcaggccaactcctaaccg 8098302  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
8098301 atgtgggactcttaaca 8098285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 21209922 - 21210038
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||| |||||||||||||||||| ||||||||||||||||  ||| ||||||||||||||| |||||||||||| |||||| |||    
21209922 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgagaattgtccccacttataaacaaattgtcaggccaactcctaaccg 21210021  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
21210022 atgtgggactcttaaca 21210038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 13296977 - 13296858
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |    
13296977 tcttagaaatcgtggttgggtctaacacaatcccacaaaaccggtttgtgaggtgagggttgcccccacttataaacaaattgtcagaccaactcctaac 13296878  T
237 cgatgtgtgactcttaacac 256  Q
    ||||| | ||||||||||||    
13296877 cgatgcgggactcttaacac 13296858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 137 - 233
Target Start/End: Complemental strand, 24528625 - 24528529
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    ||||||||||  |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||    
24528625 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcct 24528529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 17352434 - 17352552
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| ||||||||| ||||||| ||||| ||||||| ||||||||||||||| | ||||||||||||||||||||||||||||| |||||| |||     
17352434 tcttagaagtggtggttgagcctaacgcaacctcacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatctcttat- 17352532  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
17352533 cgatgtgggactcttaacac 17352552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 20510641 - 20510760
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| |||||||||||||||| ||||||||  || || |||||||||| ||||||||||||||||||| |||||||||||||| ||||||    
20510641 tcttagaaatcgtgtttgggcctaacacaactccacaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatc 20510740  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| | ||||||||||    
20510741 cgatgtggggctcttaacac 20510760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 1564566 - 1564680
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||||||||||||||  | ||||||| |||||| |||||||||||||||| ||||||||||| ||||||| ||||    
1564566 tcttagaaatcgtggttgagcctaacacaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttatc 1564665  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
1564666 cgatgtgggactctt 1564680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 139 - 253
Target Start/End: Complemental strand, 8287884 - 8287771
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||||||| || ||| ||||||||||||||| |||| ||| ||| |||||| |||    
8287884 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtggggattg-ccccacttataaacaaattgccagaccaactcctagccg 8287786  T
239 atgtgtgactcttaa 253  Q
    |||||||||||||||    
8287785 atgtgtgactcttaa 8287771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 24346736 - 24346854
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||| ||||||||||||||||||| ||||||||||||||||  || |||||||||||||| ||||||||||||||| || |||     
24346736 tcttaaaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtcttatt 24346835  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
24346836 cgatgtgggactcttaaca 24346854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 12034777 - 12034656
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||||||||||||| || ||||||  |||||||||||||||| || |||||| |||||||||| ||| ||||||||||| ||    
12034777 attcttagaaatcgtggttgggcctaacacaatcctacaaaactggcttgtgaggtgaggatttcccccatttataaacacgttggcaggccatctctta 12034678  T
235 tccgatgtgtgactcttaacac 256  Q
    |||||| || ||||||||||||    
12034677 tccgatatgggactcttaacac 12034656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 24487646 - 24487763
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||||| |||||||||| ||||||| ||||||||||||||||| || |||||||||||||||| ||| |||| ||| |||||| |||    
24487646 ttagaaatcgtggttgggcttaacacaacctcacaaaaccggcttgtgaggtgaggattacccccacttataaacatattttcagaccaactcctaaccg 24487745  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
24487746 atgtgagactcttaacac 24487763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 18333698 - 18333814
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggtt-gcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| | ||  |||||||||||||||||||||  ||||||||||||||    
18333698 tcttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctat 18333797  T
236 ccgatgtgtgactctta 252  Q
    | |||||| ||||||||    
18333798 ctgatgtgggactctta 18333814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 37782051 - 37782167
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||| |||||||||||||||||| |||| |||||||| | ||||||||||||| | |||||||||||||||||||||||||||| ||||| ||||||||    
37782051 ttagacatggtggttgggcctaactcaactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacctatccg 37782150  T
239 atgtgtgactcttaaca 255  Q
    || || |||| ||||||    
37782151 atatgagactattaaca 37782167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 42295662 - 42295546
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| || ||||||||||||||||| |||||||| ||||||||||||||||| |||| |||||||||||||| ||| |||||||| |||||| | |    
42295662 ttagaaattgtcgttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattatcaggccaactcctaactg 42295563  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
42295562 atgtgggactcttaaca 42295546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 153 - 248
Target Start/End: Original strand, 6413441 - 6413536
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||| ||||| ||||| ||||    
6413441 tgggtctaacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcatatccaatgtgagact 6413536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 136 - 251
Target Start/End: Complemental strand, 28510177 - 28510062
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||||||||||||||||||||||| |||||| |||| ||||| |||||  |||||||||||||||||||||| |||||| |||    
28510177 ttcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcaggtcatctcttat 28510078  T
236 ccgatgtgtgactctt 251  Q
    | |||||  |||||||    
28510077 ctgatgttggactctt 28510062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 17352667 - 17352785
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||| ||||||| |||||| |||||| |||||||||||||| | || |||||||||||||||||||||| ||| ||||||  ||     
17352667 tcttagaaatggtggttggacctaacataaccccgcaaaattggcttgtgaggtgaagattacccccacttataaacacattgttaggtcatctctcatt 17352766  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
17352767 cgatgtgggactcttaaca 17352785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 132 - 248
Target Start/End: Complemental strand, 21306977 - 21306861
Alignment:
132 ccgattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||| |||||||||| ||||||||| ||||||||| ||||||| | ||||||||||||||||| ||||||||||||||||| |||||| ||| |||| ||    
21306977 ccgaatcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtc 21306878  T
232 ctatccgatgtgtgact 248  Q
    || ||||||||| ||||    
21306877 ctgtccgatgtgggact 21306861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 132 - 248
Target Start/End: Complemental strand, 21314815 - 21314699
Alignment:
132 ccgattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||| |||||||||| ||||||||| ||||||||| ||||||| | ||||||||||||||||| ||||||||||||||||| |||||| ||| |||| ||    
21314815 ccgaatcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtc 21314716  T
232 ctatccgatgtgtgact 248  Q
    || ||||||||| ||||    
21314715 ctgtccgatgtgggact 21314699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 33337236 - 33337356
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||| |||| |||||||| | ||||||| |  ||||||||||| ||||||||||| | ||||||||||||||||||| |||||||||||||| |||||    
33337236 ttcttaaaaatcgtggttggacttaacacagcttcacaaaatcggtttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctat 33337335  T
236 ccgatgtgtgactcttaacac 256  Q
    || ||||| ||||||||||||    
33337336 ccaatgtgggactcttaacac 33337356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 7369798 - 7369695
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||  ||||||||||||||||||| |  ||| |||||||| ||||| ||||| |||    
7369798 gtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaacacttgttcatgccatctcttatccaatgtgggac 7369699  T
248 tctt 251  Q
    ||||    
7369698 tctt 7369695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 18885549 - 18885428
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtg--aggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    ||||||||||||||||||| |||||||||||| ||||||||  ||||||||  |||||||||||| | |||||||||||||||||||||| ||||||  |    
18885549 ttcttagaaatggtggttgtgcctaacacaactccacaaaactggcttgtgtgaggtgagggttgtctccacttataaacacattgtcagaccatctttt 18885450  T
234 atccgatgtgtgactcttaacac 256  Q
    || ||||||| ||||||||||||    
18885449 at-cgatgtgggactcttaacac 18885428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 139 - 257
Target Start/End: Original strand, 29909722 - 29909841
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttat-aaacacattgtcaggccatctcctatcc 237  Q
    ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| |||||||| ||| | |||||||  ||| |||||| |     
29909722 ttagaaatggtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaaaaaaattgtcaaaccaactcctaact 29909821  T
238 gatgtgtgactcttaacacc 257  Q
    |||||| |||||||||||||    
29909822 gatgtgggactcttaacacc 29909841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 149 - 243
Target Start/End: Complemental strand, 15438950 - 15438856
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtg 243  Q
    |||||| | |||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||| |||||||||||    
15438950 tggttgagtctaacacaaccctagaaaatcggcttgtgaggtgaggattgcccccacttataaacacattatcagaccatctcatatccgatgtg 15438856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 25258300 - 25258418
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |  |||||||||||||||||| || |||||||||||||| ||||||||||| ||||||| ||||| ||||||| |||| ||    
25258300 tcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtc 25258399  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||||||||||    
25258400 caatgtgggactcttaaca 25258418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 25322090 - 25322208
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |  |||||||||||||||||| || |||||||||||||| ||||||||||| ||||||| ||||| ||||||| |||| ||    
25322090 tcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtc 25322189  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||||||||||    
25322190 caatgtgggactcttaaca 25322208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 239
Target Start/End: Original strand, 38731837 - 38731939
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||| |||  | |||||||||||||||||||||  |||||| ||||    
38731837 tcttagaaatggtggttgtgcctaacacaacctcacaaaatcgacttgtgaggtgaggattgttctcacttataaacacattgtcagatcatctcatatc 38731936  T
237 cga 239  Q
    |||    
38731937 cga 38731939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 152 - 256
Target Start/End: Complemental strand, 15590244 - 15590139
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccc-ccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    ||||||||||||||||||||||||||| || |||||||||||| |||||| |||||||||||  ||||||||| ||||||| ||| ||||||| ||||||    
15590244 ttgggcctaacacaaccccacaaaatcagcctgtgaggtgaggattgccctccacttataaatccattgtcagaccatctcatattcgatgtgagactct 15590145  T
251 taacac 256  Q
    ||||||    
15590144 taacac 15590139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 19522403 - 19522287
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| | |||||||||||||||||||||||||||||||||||   ||| ||||||||||||| | |||||||| ||| |||||| |||    
19522403 ttagaaatcgtggttgtgtctaacacaaccccacaaaatcggcttgtgaggtgattattg-ccccacttataaataaattgtcagtccaactcctaaccg 19522305  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
19522304 atgtgggactcttaacac 19522287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 143 - 255
Target Start/End: Complemental strand, 6637680 - 6637570
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| |||||||||| ||| |||||||| ||||  ||||||||||||||||| || |||||||||||||||||||||||||||||| ||||| |||||||    
6637680 aaatcgtggttgggcttaatacaaccccgcaaac-cggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatttcctaaccgatgt 6637582  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
6637581 g-gactcttaaca 6637570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 137 - 237
Target Start/End: Original strand, 35167394 - 35167494
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | |||||||||||||||||||||||||||| |||| ||||||| || || ||||||| ||||||||||||||||||||| |||||| ||||    
35167394 tcttagaagtcgtggttgggcctaacacaaccccacaaattcggtttgtgagatggggattgccccaacttataaacacattgtcaggtcatctcttatc 35167493  T
237 c 237  Q
    |    
35167494 c 35167494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 20225124 - 20225021
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||  ||||||||||||||||||||||| |||||||||||||| ||| || || ||||||||||| ||||||| ||||| |||||||    
20225124 ttagaaatcgtggttgaacctaacacaaccccacaaaatcgacttgtgaggtgaggattgtcctcatttataaacacactgtcaggtcatcttctatccg 20225025  T
239 atgt 242  Q
    ||||    
20225024 atgt 20225021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 38731602 - 38731721
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||| ||||||| |||||||||||| || |||||||||||||||||||  | |||| | |||||||||| | ||||||||| |||||||||||    
38731602 tcttagaaatgatggttggacctaacacaacctcataaaatcggcttgtgaggtggtgattgctctcacttataaataaattgtcaggtcatctcctatc 38731701  T
237 cgatgtgtgactcttaacac 256  Q
    |||||||  || ||||||||    
38731702 cgatgtggaacacttaacac 38731721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 207
Target Start/End: Original strand, 25258093 - 25258163
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||    
25258093 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccactt 25258163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 207
Target Start/End: Original strand, 25321883 - 25321953
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||    
25321883 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccactt 25321953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 142 - 256
Target Start/End: Original strand, 29909491 - 29909605
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    |||||||||||| | |||||||||| ||||||||| ||  ||||||||||||| ||||| ||||||||||| | |||||||||||| |||||| ||||||    
29909491 gaaatggtggttagacctaacacaatcccacaaaaccgatttgtgaggtgaggattgcctccacttataaataaattgtcaggccaactcctaaccgatg 29909590  T
242 tgtgactcttaacac 256  Q
    |  ||||||||||||    
29909591 tcggactcttaacac 29909605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 139 - 237
Target Start/End: Original strand, 37656938 - 37657036
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||| ||||||||||||||||||  |||||||||||| || |||||||||| ||| || ||||||||||||||||||||||||| ||||| |||||||    
37656938 ttagacatggtggttgggcctaacttaaccccacaaaaccgacttgtgaggtaaggattacccccacttataaacacattgtcagaccatcacctatcc 37657036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 150 - 251
Target Start/End: Original strand, 170563 - 170664
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||  |||||||||||||||||||||  | || ||||||  | |||||||||||||||    
170563 ggttgggcctaacacaacctcacaaaaccggcttgtgaggtgaggactgcccccacttataaacacatgcttagaccatcttttgtccgatgtgtgactc 170662  T
250 tt 251  Q
    ||    
170663 tt 170664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 6637916 - 6637803
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||  |||||||| |||||  ||| ||| ||||||||||||| |||| |||||||||| ||||||||||||| ||||||||| |||||||    
6637916 aaatcgtggttggatctaacacagccccaataaaccggtttgtgaggtgaggattgcacccacttatagacacattgtcaggtcatctcctaaccgatgt 6637817  T
243 gtgactcttaacac 256  Q
    | ||||||||||||    
6637816 gggactcttaacac 6637803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 149 - 256
Target Start/End: Original strand, 17015890 - 17015994
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||  |||||| |||||||||||| |||||    | ||||  ||||||||||| ||||    
17015890 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattgccctcacttataaacatattgt---acaatcttgtatccgatgtgggact 17015986  T
249 cttaacac 256  Q
    ||||||||    
17015987 cttaacac 17015994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 43117967 - 43117846
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| || ||||||||||||||||||| | |||| ||||||||||| ||||| |||||| || ||||||||||||||||||||||| |||| ||    
43117967 tcttaaaaatcgttgttgggcctaacacaaccctataaaaccggcttgtgagatgaggattgccctcatttataaacacattgtcaggccatgtcctgtc 43117868  T
237 cgatg-tgtgactcttaacacc 257  Q
    ||| | || |||||||||||||    
43117867 cgaagttgggactcttaacacc 43117846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 60172 - 60092
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| ||| ||||| |||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||    
60172 tcttagaaattgtgattgggtctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacat 60092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 7607677 - 7607561
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||||||||||||||||| |||||||| ||||||||||||||| | ||| | ||||||||||||| |||||| ||||||  ||||  ||    
7607677 ttagaaatcatggttgggcctaacacaactccacaaaaccggcttgtgaggtgaagattgtctccacttataaacagattgtcgggccataacctagtcg 7607578  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
7607577 atgtgagactcttaaca 7607561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 253
Target Start/End: Original strand, 13701067 - 13701183
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||| ||||||||||| || ||  || ||||||  |||||||||||||||||||||||||| |  ||| |||||||    
13701067 tcttagaaatcgtggttaggcctaacacgaccccacaaaaccgactcttggggtgagaattgcccccacttataaacacattgtcggatcatttcctatc 13701166  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
13701167 cgatgtgggactcttaa 13701183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 139 - 234
Target Start/End: Complemental strand, 19522170 - 19522075
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||| ||||||||| | || |||||||||||||| ||||||||||||||||| ||||||||||| ||||||| |||| ||||||| ||||||    
19522170 ttagaaatcgtggttgggtcaaatacaaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaacaaattgacaggccaactccta 19522075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 24270105 - 24270223
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc-ctat 235  Q
    ||||| |||| |||||||| | |||||||||||||||||| ||||||||||||||||  || |||||||||||||| ||||||||||||||| ||  |||    
24270105 tcttaaaaatcgtggttggtc-taacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtctttat 24270203  T
236 ccgatgtgtgactcttaaca 255  Q
     ||||||| |||||||||||    
24270204 tcgatgtgggactcttaaca 24270223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 163 - 257
Target Start/End: Complemental strand, 8098610 - 8098516
Alignment:
163 acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacacc 257  Q
    |||||||||||||| ||||||||||||||||| ||| |  | |||||||||| |||||||||||| |||||| |||||||| |||||||||||||    
8098610 acaaccccacaaaaccggcttgtgaggtgaggattgtctgcgcttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacacc 8098516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 243
Target Start/End: Complemental strand, 13296757 - 13296652
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||| ||||||  |||||||||||||||| ||||||||||||||||| | |||||||  ||| ||| || |    
13296757 tcttagaaatcgtggttgggcctaacacaaccc-acaaaactggcttgtgaggtgaggattgcccccacttataaataaattgtcaaaccaactcttaac 13296659  T
237 cgatgtg 243  Q
    |||||||    
13296658 cgatgtg 13296652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 154 - 248
Target Start/End: Original strand, 30758315 - 30758409
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    ||||||||| || ||  |||||| |||||| |||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||| ||||    
30758315 gggcctaactcatccttacaaaaccggcttatgaggtgaggattgcccccccttataaacacattgtcaggccatgtcctatccgatgtgggact 30758409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 4481604 - 4481681
Alignment:
179 ggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||| |||||| ||||||||| |||||||||||||||||||||| || |||||||||||| ||||||||||||    
4481604 ggcttgtgacgtgaggattgcccccatttataaacacattgtcaggccaacttctatccgatgtgggactcttaacac 4481681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 38977018 - 38976913
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||||||| | |||||||| ||| ||||||||||||| ||| ||| |||||||||||||||||||| | || ||||||     
38977018 tcttagaaatcgtggttgtgcctaacacacctccacaaaaccggtttgtgaggtgaggattgtcccaacttataaacacattgtcagacaatgtcctatt 38976919  T
237 cgatgt 242  Q
    ||||||    
38976918 cgatgt 38976913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 161 - 249
Target Start/End: Original strand, 2061961 - 2062049
Alignment:
161 acacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    |||||||| ||||| | ||||||||||||||| | ||||||||||||||||||||||||||||||||| | ||||||| |||| |||||    
2061961 acacaaccacacaagaccggcttgtgaggtgaagattgcccccacttataaacacattgtcaggccatgttctatccggtgtgggactc 2062049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 6413658 - 6413773
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| || ||||||  ||||||||||||| |||| |||||| |||||||||| ||| ||| |||||||||||||||||||   |||||| ||||||    
6413658 ttagaaatcgttgttgggtttaacacaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaacacattgtca-atcatctcatatccg 6413756  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
6413757 atgtgggactcttaaca 6413773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 33337454 - 33337568
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||  |||||||||||||||||||| ||| ||||||| ||||| ||| ||||||||| |   ||||||||||| |||| ||||||    
33337454 tcttagaaatcgtggttgaacctaacacaaccccacaaaaccggtttgtgagatgaggattg-ccccacttaca---acattgtcaggtcatcacctatc 33337549  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
33337550 cgatgtgggactcttaaca 33337568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 32908717 - 32908836
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| |||||| |||||| ||||| ||| ||||||||||| | ||||| ||||||||||||||||||||||  ||||  ||||     
32908717 tcttagaaatcgtggttgggtctaacataacccctcaaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcagatcatcctctatt 32908816  T
237 cgatgtgtgactcttaacac 256  Q
    | ||||  ||||||||||||    
32908817 caatgtaggactcttaacac 32908836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 6919428 - 6919544
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||| ||||||||||||| ||||||| | ||||||||||||||  ||| |||||||||||||||||||||||   |||||| ||||    
6919428 tcttaaaaatcgtggttgagcctaacacaacctcacaaaa-ctgcttgtgaggtgagaattgtccccacttataaacacattgtca-atcatctcatatc 6919525  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||||||||||    
6919526 ctatgtgagactcttaaca 6919544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 154 - 256
Target Start/End: Original strand, 30770065 - 30770167
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||| || ||  |||||| ||| || |||||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |||||||||    
30770065 gggcctaactcatccttacaaaaccggtttatgaggtgaggattgcccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaa 30770164  T
254 cac 256  Q
    |||    
30770165 cac 30770167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 251
Target Start/End: Complemental strand, 7092221 - 7092121
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    |||||||||||||||||||||||||||  |||||||||||||||| |||||||||| | |||||||||  || ||||||||  ||||| ||||| |||||    
7092221 ggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccac-tctaaacacatgttcgggccatctgttatccaatgtgggactc 7092123  T
250 tt 251  Q
    ||    
7092122 tt 7092121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 156 - 256
Target Start/End: Original strand, 3859326 - 3859426
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||||   |||||||||||||| ||| || |||||||||||||||| ||||| ||| | ||||||||| || |||||||||||    
3859326 gcctaacataaccccacaaaattaacttgtgaggtgaggattgtcctcacttataaacacattatcaggtcatgttctatccgatatgggactcttaaca 3859425  T
256 c 256  Q
    |    
3859426 c 3859426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 13700588 - 13700708
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  || |||| | |||||||||| ||||||| |||||| |||||||||  ||| ||  ||||||||||||||||||| | |||||||||||    
13700588 tcttagaaatcatgattggacataacacaacctcacaaaaccggcttttgaggtgagaattgtccaaacttataaacacattgtcaagtcatctcctatc 13700687  T
237 cgat-gtgtgactcttaacac 256  Q
    |||| ||| ||||||||||||    
13700688 cgatggtgggactcttaacac 13700708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 184 - 256
Target Start/End: Original strand, 17150279 - 17150351
Alignment:
184 gtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||   |||||||||||    
17150279 gtgaggtgaggattgcccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaacac 17150351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 30770298 - 30770382
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||| | |||| |||||||||| ||||||||||||||||||||||||||| ||||| |||||||| | ||| |||||||||||    
30770298 acaaaaccagcttatgaggtgaggattgcccccacttataaacacattgtcaagccatgtcctatccaaagtgagactcttaaca 30770382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 142 - 217
Target Start/End: Original strand, 16707029 - 16707104
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||| ||||||||||||||||||||||  ||||| | ||||||||||| ||| ||||||||||||||||||||||    
16707029 gaaatcgtggttgggcctaacacaaccctgcaaaaccagcttgtgaggttaggattgcccccacttataaacacat 16707104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 149 - 256
Target Start/End: Complemental strand, 37405162 - 37405055
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgact 248  Q
    |||||||| |||| |||||||||||||| |||||| ||||||| || ||||||||||||| |||||| || |||| |||||||  | | |||||| ||||    
37405162 tggttgggtctaatacaaccccacaaaaccggcttttgaggtggggattgcccccacttacaaacactttttcagaccatctctcaactgatgtgggact 37405063  T
249 cttaacac 256  Q
    ||||||||    
37405062 cttaacac 37405055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 231
Target Start/End: Original strand, 2986011 - 2986105
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctc 231  Q
    |||||||||||||||||| ||||||||||||||||||||  |  ||||| |||||||  ||||||| |||||||||||| |||||| | ||||||    
2986011 tcttagaaatggtggttgagcctaacacaaccccacaaatccaacttgtaaggtgagaattgccccgacttataaacactttgtcatgtcatctc 2986105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 223
Target Start/End: Complemental strand, 15439072 - 15438986
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| |||||| ||||||||||||||||| ||||  | |||||||||||| | ||||||||||||||| ||||||||||||    
15439072 tcttataaatcgtggttaggcctaacacaaccccataaaactgacttgtgaggtgatgattgcccccacttatagacacattgtcag 15438986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 139 - 253
Target Start/End: Original strand, 26137110 - 26137224
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||| || |||||| |||||||||||| ||| ||||||| ||||| ||||||||| |||||||||  ||||||   ||| |||||| ||    
26137110 ttagaaatcgtggttaggtctaacataaccccacaaaaccggtttgtgagatgaggattgcccccatttataaacatgttgtcatatcatttcctattcg 26137209  T
239 atgtgtgactcttaa 253  Q
    ||||| |||||||||    
26137210 atgtgggactcttaa 26137224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 138 - 255
Target Start/End: Original strand, 26137345 - 26137463
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttat-aaacacattgtcaggccatctcctatc 236  Q
    ||||||||| |||||||||||||||| || ||||||||| |  |||||||| ||||| ||| | |||||||| ||| |||||||||| ||||||| ||||    
26137345 cttagaaatcgtggttgggcctaacataatcccacaaaaccaacttgtgagatgaggattgtcgccacttataaaaaacattgtcagaccatctcatatc 26137444  T
237 cgatgtgtgactcttaaca 255  Q
    | || || |||||||||||    
26137445 caatatgagactcttaaca 26137463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 6919227 - 6919312
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||| |||||| | |||||||| ||||||||||| ||||||||||||||||| |||||| |||  |||||| ||||||||||||    
6919227 acaaaaccggcttttaaggtgaggattgcccccactaataaacacattgtcaggtcatctcttatttgatgtgggactcttaacac 6919312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 152 - 228
Target Start/End: Original strand, 17899474 - 17899550
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    ||||||||||| || || |||||||||||||  |||||||||| ||||||||||||||||||||||  |||||||||    
17899474 ttgggcctaactcatcctcacaaaatcggctcatgaggtgaggattgcccccacttataaacacatgttcaggccat 17899550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 135 - 255
Target Start/End: Complemental strand, 29239998 - 29239881
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||| ||||||||| ||||||||| |   ||||||||||| | ||  ||||||||||||||||||||||| | |||| ||||    
29239998 attcttagaaattgtggttgggtctaacacaaacccacaaaa-ccatttgtgaggtgatgatt-accccacttataaacacattgtca-gacatcaccta 29239902  T
235 tccgatgtgtgactcttaaca 255  Q
    || |||||| |||||||||||    
29239901 tcagatgtgagactcttaaca 29239881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 2985272 - 2985341
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||| || |||||| ||||||||||||||||||  |||||| ||||||| |||||||||||    
2985272 ttgtgaggtgaggattacccccaattataaacacattgtcagatcatctcatatccgaggtgtgactctt 2985341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 199 - 256
Target Start/End: Complemental strand, 13358424 - 13358367
Alignment:
199 cccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||||||||||||||| | |||||||||| |||||| ||||||||||||    
13358424 cccccacttataaacacattgtcagccaatctcctatctgatgtgagactcttaacac 13358367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 9187372 - 9187320
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgag 188  Q
    ||||||||||| ||||||| | |||||||||||||||||||||||||||||||    
9187372 ttcttagaaatcgtggttgagtctaacacaaccccacaaaatcggcttgtgag 9187320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 237
Target Start/End: Original strand, 16571459 - 16571559
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || ||||| ||||||| |||||||||||| |   || |||||||||| || |||||||||| ||||||||||||||  ||||| |||||    
16571459 tcttagaaatcgttgttggacctaacataaccccacaaaaccaatttatgaggtgaggatttcccccacttaaaaacacattgtcagatcatcttctatc 16571558  T
237 c 237  Q
    |    
16571559 c 16571559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 163 - 255
Target Start/End: Original strand, 17017116 - 17017208
Alignment:
163 acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||| |||| ||| || |||||||||||| | ||| ||||||||||||||||||||||  ||||||| ||||| ||| || |||||||||||    
17017116 acaacaccactaaaccgacttgtgaggtgatgattgaccccacttataaacacattgtcgagccatcttctatctgatatgggactcttaaca 17017208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 173 - 253
Target Start/End: Original strand, 31181046 - 31181126
Alignment:
173 aaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    |||||||| ||||||||||| | |||||||||| |||||||| ||||||| | |||| ||||||||||||| || ||||||    
31181046 aaaatcggtttgtgaggtgatgattgcccccacatataaacatattgtcaagtcatcacctatccgatgtgggaatcttaa 31181126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 169 - 255
Target Start/End: Complemental strand, 37656666 - 37656582
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||| |||||| || |||  |||||||||||||||||||| ||||  ||||||||| ||| |||||||||||    
37656666 ccacaaaaccggcttgtgatgtgaggatttccc--acttataaacacattgtcagaccattacctatccgacgtgggactcttaaca 37656582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 21209709 - 21209763
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgag 193  Q
    |||||||| ||||||| || |||||||||||||||||| ||||||||||||||||    
21209709 ttagaaatcgtggttgtgcttaacacaaccccacaaaaccggcttgtgaggtgag 21209763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 12151929 - 12151986
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    ||||||||||||| ||||||| |||||||||||||||||| | ||| |||||||||||    
12151929 gcctaacacaacctcacaaaaccggcttgtgaggtgagggcttccctcacttataaac 12151986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 139 - 175
Target Start/End: Original strand, 1028399 - 1028435
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaa 175  Q
    |||||||||||||||||||||||||||||||||||||    
1028399 ttagaaatggtggttgggcctaacacaaccccacaaa 1028435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 16293434 - 16293320
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||| ||| ||||| ||||||| | |  |||||| |||||| ||||||| ||||||||||||||||| ||  |||| |||||     
16293434 tcttagaaatcgtggttgggcttaatacaactccacaaactagt-ttgtgaagtgaggattgcccc-acttataaacacattgttagatcatcccctatt 16293337  T
237 cgatgtgtgactcttaa 253  Q
     |||||| |||||||||    
16293336 tgatgtgagactcttaa 16293320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 200 - 256
Target Start/End: Complemental strand, 24528797 - 24528741
Alignment:
200 ccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||| ||||||||||||||||| |||| || |||||| ||||||||||||    
24528797 ccccacttatatacacattgtcaggccatgtcctctcagatgtgggactcttaacac 24528741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 253
Target Start/End: Original strand, 36040475 - 36040591
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||| |||||||||||||| | ||||    |||||||||||| | ||||  ||||||||||||||||| ||||  ||||| |||||    
36040475 tcttagaaatcatggttgagcctaacacaaccctataaaacaaacttgtgaggtgatgattgcaaccacttataaacacattatcagatcatcttctatc 36040574  T
237 cgatgtgtgactcttaa 253  Q
     ||||||  ||||||||    
36040575 tgatgtgaaactcttaa 36040591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 169 - 240
Target Start/End: Complemental strand, 37781778 - 37781709
Alignment:
169 ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||||| || |||||||||||||| ||| ||  |||||||||||||||||||| ||||| ||||||||||    
37781778 ccacaaaaccgacttgtgaggtgaggattgtcc--acttataaacacattgtcagaccatcacctatccgat 37781709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 139 - 253
Target Start/End: Original strand, 11896683 - 11896800
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgt---gaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    |||||||| ||||||   |||||||||||||||| |||| | |||||   ||||||| | |||||||||||||| |||||||| ||| | |||   ||||    
11896683 ttagaaatcgtggttaaacctaacacaaccccactaaattgacttgttgtgaggtgatgattgcccccacttattaacacattatcaagtcattatctat 11896782  T
236 ccgatgtgtgactcttaa 253  Q
    |||||||| |||||||||    
11896783 ccgatgtgcgactcttaa 11896800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 136 - 219
Target Start/End: Complemental strand, 18140944 - 18140861
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattg 219  Q
    ||||||||||| ||||||||| |||| |||| |||| |||| | | |||||| |||||| || ||||||| |||||||||||||    
18140944 ttcttagaaatcgtggttgggtctaatacaatcccataaaaccagtttgtgaagtgaggattacccccacctataaacacattg 18140861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 25436259 - 25436193
Alignment:
164 caaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatct 230  Q
    ||||||||||||| ||||||||||||||||| || |||  ||||||||||||||  ||| |||||||    
25436259 caaccccacaaaaccggcttgtgaggtgaggatttcccttacttataaacacatgttcaagccatct 25436193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 31974289 - 31974239
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgc 199  Q
    ||||||||||||||||||||||||||||  |||||||| ||||||| ||||    
31974289 tggttgggcctaacacaaccccacaaaactggcttgtgcggtgaggattgc 31974239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 153 - 215
Target Start/End: Complemental strand, 31974505 - 31974443
Alignment:
153 tgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||||||||  ||||||  |||| |||||||||||  |||||||||||||||||||    
31974505 tgggcctaacacaaccttacaaaactggctcgtgaggtgaggactgcccccacttataaacac 31974443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 200 - 256
Target Start/End: Original strand, 11895977 - 11896033
Alignment:
200 ccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| ||||||||||| |||| ||||||| ||||  ||||||||||||    
11895977 ccccacttataaatacattgtcaggtcatcacctatccaatgtaagactcttaacac 11896033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 40855651 - 40855699
Alignment:
72 aatgctttataggcctctcgcattgctcaaaagatcatcagatttatca 120  Q
    |||| |||||||||||||| |||| |||||||| |||||||||||||||    
40855651 aatgttttataggcctctcacatttctcaaaagctcatcagatttatca 40855699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 256
Target Start/End: Complemental strand, 17584238 - 17584139
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||| |||||||| || ||||| | |||||| ||||||| || ||||||||||| |  |   ||||||||||| |||| | ||||||||||||    
17584238 cctaacacaactccacaaaaccgacttgtaaagtgaggattgccccaacatataaacacatcgataactcatctcctatctgatgggggactcttaacac 17584139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 7104338 - 7104239
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccact-tataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    ||||||||||||||  |||||||||| ||| ||||  ||||||| ||||| ||||| | |||||||||  | ||| ||||| |||||||||||| |||||    
7104338 gttgggcctaacacgtccccacaaaaccggtttgt--ggtgaggattgcctccactctctaaacacatgtttaggtcatctgctatccgatgtgggactc 7104241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 43117732 - 43117694
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaa 175  Q
    |||||||||| || |||||||||||||||||||||||||    
43117732 tcttagaaatcgttgttgggcctaacacaaccccacaaa 43117694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 18885328 - 18885276
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||  |||| |||||||||| |||||||| |||||||||||    
18885328 ccacttataaacacatcatcagaccatctccta-ccgatgtgggactcttaaca 18885276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 29434145 - 29434081
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||| ||| || |||||||||| ||||||||||||||| ||  | ||||||||||||||||||    
29434145 ttgggcccaacccagccccacaaaaccggcttgtgaggtga-ggacggccccacttataaacacat 29434081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 34328994 - 34328945
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgag 188  Q
    |||||||| ||| ||||||||||||||||  ||||||| |||||||||||    
34328994 ttagaaatcgtgattgggcctaacacaacttcacaaaaccggcttgtgag 34328945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 203 - 255
Target Start/End: Original strand, 16704013 - 16704065
Alignment:
203 cacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||| |  ||||||||||||  ||||| |||||||||||    
16704013 cacttataaacacattgttaaaccatctcctatctaatgtgagactcttaaca 16704065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 216 - 256
Target Start/End: Original strand, 21209765 - 21209805
Alignment:
216 attgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||| |||||| |||||||| ||||||||||||    
21209765 attgtcaggccaactcctaaccgatgtgggactcttaacac 21209805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 216 - 256
Target Start/End: Complemental strand, 26245989 - 26245949
Alignment:
216 attgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| | |||||||||||||||||| ||||||||||||    
26245989 attgtcatgtcatctcctatccgatgtgggactcttaacac 26245949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 96; Significance: 9e-47; HSPs: 104)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 16419587 - 16419468
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||    
16419587 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatc 16419488  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
16419487 cgatgtgggactcttaacac 16419468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 40379208 - 40379327
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||    
40379208 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatc 40379307  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
40379308 cgatgtgggactcttaacac 40379327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 40379443 - 40379561
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||    
40379443 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatc 40379542  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
40379543 cgatgtgggactcttaaca 40379561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 5711436 - 5711557
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||     
5711436 attcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctt 5711535  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
5711536 tccgatgtgggactcttaacac 5711557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 14466409 - 14466527
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||||||||||||||||||||| |||| ||    
14466409 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaacacattgtcaggccatgtcctgtc 14466508  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
14466509 cgatgtgggactcttaaca 14466527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 17719485 - 17719367
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||| |||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||    
17719485 tcttagaaattgtggttgggccgaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatc 17719386  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
17719385 cgatgtgggactcttaaca 17719367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 5711674 - 5711793
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| |||||| | |||||| | ||||||||||||||||||||||||||||||||| |||| ||    
5711674 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttttaaggtgatgattgcccccacttataaacacattgtcaggccatgtcctgtc 5711773  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
5711774 cgatgtgggactcttaacac 5711793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 2029854 - 2029736
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||||    
2029854 tcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcctatc 2029755  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
2029754 cgatgtgggactcttaaca 2029736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 2324319 - 2324206
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| ||| |||||| |||||||    
2324319 aaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgt 2324220  T
243 gtgactcttaacac 256  Q
    | ||||||||||||    
2324219 gggactcttaacac 2324206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 151 - 255
Target Start/End: Complemental strand, 32884178 - 32884074
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||||||| ||||||    
32884178 gttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactct 32884079  T
251 taaca 255  Q
    |||||    
32884078 taaca 32884074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 2030089 - 2029970
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||| || | ||    
2030089 tcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtc 2029990  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
2029989 cgatgtgggactcttaacac 2029970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 27897605 - 27897723
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||||||||||  ||| ||||||||||||||| |||||||||||| |||||| |    
27897605 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgagaattg-ccccacttataaacaaattgtcaggccaactcctaac 27897703  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
27897704 cgatgtgggactcttaacac 27897723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 142 - 256
Target Start/End: Complemental strand, 2324554 - 2324440
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatg 241  Q
    ||||| ||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| || ||| ||||||    
2324554 gaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaacttctaaccgatg 2324455  T
242 tgtgactcttaacac 256  Q
    || ||||||||||||    
2324454 tgggactcttaacac 2324440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 134 - 256
Target Start/End: Original strand, 15124544 - 15124666
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||||||| |||| ||||||||| |||||||||||||||||||||||||| ||||||| || ||||||||||||||||||| |||||||| |||| | ||    
15124544 gattcttaaaaatcgtggttgggtctaacacaaccccacaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttct 15124643  T
234 atccgatgtgtgactcttaacac 256  Q
    |||||||||| ||||||||||||    
15124644 atccgatgtgggactcttaacac 15124666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 28407792 - 28407910
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||| ||||||  ||||| |    
28407792 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttaggccaattcctaac 28407891  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
28407892 cgatgtgggactcttaaca 28407910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 138 - 256
Target Start/End: Complemental strand, 29718412 - 29718294
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||| ||||||| |||| |||||| ||    
29718412 cttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaagccaactcctaacc 29718313  T
238 gatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||    
29718312 gatgtgggactcttaacac 29718294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 37840422 - 37840304
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||||| ||||||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||||||||| |||||||||||    
37840422 tcttaaaaattgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaacacattgtcaggtcatctcctatc 37840323  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||||||||||    
37840322 caatgtgggactcttaaca 37840304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 31700743 - 31700866
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggg---ttgcccccacttataaacacattgtcaggccatctcc 232  Q
    ||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||  ||   |||||| ||||||||||||||||||||||||||| ||    
31700743 ttcttagaaatcgtggttgggcctaacacaaacccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacc 31700842  T
233 tatccgatgtgtgactcttaacac 256  Q
    |||||||||||| |||||||||||    
31700843 tatccgatgtgtaactcttaacac 31700866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 40149004 - 40149121
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||| ||| ||||| |||||||    
40149004 ttagaaatcatggttggacctaacacaaccccacaaaatcggcttgtgaggtgaggattgtccccacttataaacacactgttaggtcatcttctatccg 40149103  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
40149104 atgtgagactcttaacac 40149121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 19191611 - 19191727
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| | |||||||||| |||||| |||    
19191611 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaactgtcaggccaactcctaaccg 19191710  T
239 atgtgtgactcttaaca 255  Q
    ||| | |||||||||||    
19191711 atgggggactcttaaca 19191727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 139 - 253
Target Start/End: Complemental strand, 5509162 - 5509048
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  |||||||||||||||||||||||||||| | ||||||||||||||| || |||||||||||||||| |||||||| ||| |||||| |||    
5509162 ttagaaatcatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattacccccacttataaacaaattgtcagaccaactcctaaccg 5509063  T
239 atgtgtgactcttaa 253  Q
    |||||||||||||||    
5509062 atgtgtgactcttaa 5509048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 17854930 - 17855047
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||| ||| ||||||||||||||| ||||||||||||||||| |||||| |||||||||||| ||||||||| || |||||| |||    
17854930 ttagaaatcgtggttgggtctagcacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggtcaactcctaaccg 17855029  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
17855030 atgtgagactcttaacac 17855047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 25082536 - 25082655
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| ||||||||||||||||||||  |||||||||||||| | ||||||| |||||||||||||||||||| ||||||| ||||    
25082536 tcttagaaatcgtggttggacctaacacaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttatc 25082635  T
237 cgatgtgtgactcttaacac 256  Q
     ||| || ||||||||||||    
25082636 tgatatgagactcttaacac 25082655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 134 - 256
Target Start/End: Original strand, 36351921 - 36352044
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaa-tcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    ||||||||||||| |||||||||||||||| |||||||||||| |  ||||||||||||||  ||| ||||||||||||||||||||||||| | |||||    
36351921 gattcttagaaatcgtggttgggcctaacataaccccacaaaaatttgcttgtgaggtgagaattgtccccacttataaacacattgtcaggtcgtctcc 36352020  T
233 tatccgatgtgtgactcttaacac 256  Q
    ||||||||||  ||||||||||||    
36352021 tatccgatgtaagactcttaacac 36352044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 137 - 251
Target Start/End: Complemental strand, 14927187 - 14927073
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| ||||||||||||| ||||||   | ||| |||||||||| ||||||||||||||||||||||||||||| |||||| ||||    
14927187 tcttagaaatcgtggttgagcctaacacaaccacacaaagctgacttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcttatc 14927088  T
237 cgatgtgtgactctt 251  Q
    |||||||||||||||    
14927087 cgatgtgtgactctt 14927073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 13486417 - 13486300
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||| |||||| |||||||||||||||||||||||| | ||||||||||||| ||| |||||||||||||| | |||||||||||| |||||| ||    
13486417 ttagaaatcgtggttaggcctaacacaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaacc 13486318  T
238 gatgtgtgactcttaaca 255  Q
    |||||| |||||||||||    
13486317 gatgtgggactcttaaca 13486300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 17854693 - 17854810
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||| ||||||||| || |||||||| ||| | ||||||||||||||||||| |||||||||| | |||||| |||    
17854693 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgagatgatgattgcccccacttataaacagattgtcaggctaactcctaaccg 17854792  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
17854793 atgtgggactcttaacac 17854810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 33606056 - 33606172
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||| |||||| ||  |||||||| ||| ||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||    
33606056 ttagaaatcgtggttgggtctaaca-aattccacaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccg 33606154  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
33606155 atgtgggactcttaacac 33606172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 148 - 255
Target Start/End: Original strand, 17525349 - 17525455
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    ||||||||||||| ||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||| || | ||||||||| |||    
17525349 gtggttgggccta-cacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcatgtccgatgtgggac 17525447  T
248 tcttaaca 255  Q
    ||||||||    
17525448 tcttaaca 17525455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 158 - 256
Target Start/End: Complemental strand, 16533611 - 16533513
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||| ||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||| |||  ||||||||||||    
16533611 ctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaggccatcacctatccggtgtaggactcttaacac 16533513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 5509392 - 5509279
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| |||||||| |||||||| ||||||||||| ||||||||| ||||||| ||||||||||||||||||| |||||| ||||| |||||| | |||||    
5509392 aaatcgtggttggacctaacactaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacaaattgtcgggccaactcctaactgatgt 5509293  T
243 gtgactcttaacac 256  Q
    | ||||||||||||    
5509292 gggactcttaacac 5509279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 37812301 - 37812386
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
37812301 acaaaatcgacttgtgaggtgaggattgtccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaacac 37812386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 5851680 - 5851802
Alignment:
137 tcttagaaatggtggttgggcctaacacaacc-ccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt---caggccatctcc 232  Q
    ||||||||||| ||||||| |||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||| |||||||   |||||||| |||    
5851680 tcttagaaatgatggttggacctaacacaacctccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcagcaggccatgtcc 5851779  T
233 tatccgatgtgtgactcttaaca 255  Q
    | ||||||||| |||||||||||    
5851780 tgtccgatgtgggactcttaaca 5851802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 12343751 - 12343867
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||  ||||||||| |||||||||||||||||||  | ||| ||| |||||| |||||||||||||||| ||||||||| | ||||||||||||||    
12343751 ttagaaaccgtggttgggtctaacacaaccccacaaaactgacttatgatgtgaggattgcccccacttataagcacattgtctgaccatctcctatccg 12343850  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
12343851 atgtgggactcttaaca 12343867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 249
Target Start/End: Complemental strand, 24395948 - 24395837
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||||||  ||||||||||||| ||| ||||||| ||||||||||||| |||||||| ||||||    
24395948 tcttagaaatcgtggtttggcctaacacaaccccacaaaatcgatttgtgaggtgaggattg-ccccactcataaacacattgttaggccatcacctatc 24395850  T
237 cgatgtgtgactc 249  Q
     |||||| |||||    
24395849 tgatgtgggactc 24395837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 37769948 - 37770060
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||| ||||||||||||||||||| |||||| |||||||| | ||||||||||||||||||| |||||||  ||| |||||| |||||||    
37769948 aaatcgtggttgggtctaacacaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaacaaattgtcaaaccaactcctaaccgatgt 37770047  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
37770048 gggactcttaaca 37770060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 154 - 258
Target Start/End: Original strand, 37812514 - 37812618
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||| || ||  ||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||| || ||||||||||| |||||||||    
37812514 gggcctaactcatccttacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaa 37812613  T
254 caccg 258  Q
    |||||    
37812614 caccg 37812618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 9927996 - 9927893
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | |||||||| | ||||||||||||| |||||| ||||||||||||||| || ||||||||||||||||||||||||| |||||| |||||    
9927996 tcttagaattcgtggttggacgtaacacaaccccaaaaaatcagcttgtgaggtgaggattacccccacttataaacacattgtcagaccatcttctatc 9927897  T
237 cgat 240  Q
    ||||    
9927896 cgat 9927893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 27036416 - 27036530
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||||  ||||||||||||||||||||| |||||| |||||| ||||| ||   ||||||||||||||||||| |||||||||||| |||||| |||    
27036416 ttagaaatcatggttgggcctaacacaaccctacaaaaccggcttatgagggga---ttgcccccacttataaacaaattgtcaggccaactcctaaccg 27036512  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
27036513 atgtgggactcttaacac 27036530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 42639613 - 42639731
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||| |||||||||||| ||||||||||||||||||| | ||||||||||||| | ||| ||||| |||||||||||||||||| |||| || |||     
42639613 tcttagagatggtggttgggtctaacacaaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccatgtcatatt 42639712  T
237 cgatgtgtgactcttaaca 255  Q
    | ||||| |||||||||||    
42639713 caatgtgggactcttaaca 42639731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 94052 - 94137
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||| || |||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||    
94052 cacaaaaccgacttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca 94137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 32356469 - 32356353
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||| | || ||||||||||||||||| ||||||||  |||||||| ||||||| ||||||||||||||||||||||||||| | |||||| | |||    
32356469 cttagaattcgtagttgggcctaacacaactccacaaaactggcttgtg-ggtgaggattgcccccacttataaacacattgtcatgtcatctcatgtcc 32356371  T
238 gatgtgtgactcttaaca 255  Q
    |||||| |||||||||||    
32356370 gatgtgagactcttaaca 32356353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 36316052 - 36316169
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||| ||||||| ||||||||||||  ||||||| | |||||| ||||||||||||||||||| |||||||||||| || ||| | |    
36316052 ttagaaatcgtggttggacctaacataaccccacaaaactggcttgtaatgtgaggattgcccccacttataaacaaattgtcaggccaacttctaactg 36316151  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
36316152 atgtgggactcttaacac 36316169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 40718212 - 40718324
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||| ||||||||||||||||||| |||||||| ||| ||||||||||| | |||||| |||||||||||| ||||| ||| || |||||| |||||||    
40718212 aaatgatggttgggcctaacacaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaacaaattgttaggtcaactcctaaccgatgt 40718311  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
40718312 gagactcttaaca 40718324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 21591866 - 21591748
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||| |||||||||||||||||||||||| |||| || ||| |||||||| | ||| |||||||||||||||| |||||||| ||| ||||||      
21591866 cttagaaatcgtggttgggcctaacacaaccccataaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcagaccaactcctaat 21591767  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
21591766 cgatgtgggactcttaaca 21591748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 93120 - 93240
Alignment:
136 ttcttagaaatggtggttggg-cctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||||||| || |||||| |||||| || ||  |||||| |||||||| ||||||||  |||||||||||||||||||||||||||| |||| ||||    
93120 ttcttagaaatcgtagttggggcctaactcatccttacaaaaccggcttgtaaggtgaggagtgcccccacttataaacacattgtcagg-catcaccta 93218  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
93219 tccgatgtgggactcttaacac 93240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 17719651 - 17719575
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    |||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| ||| ||||||||||||||||||    
17719651 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 19570973 - 19571053
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| |||||||||||||||||||  ||||||||||| ||| |||||||||| ||||||||||||||||||||||    
19570973 tcttagaaatcgtggttgggcctaacacaattccacaaaatcgacttatgaggtgaggattgcccccacttataaacacat 19571053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 227
Target Start/End: Complemental strand, 14927378 - 14927288
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggcca 227  Q
    |||||||||  ||| ||||| |||| ||||| ||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||    
14927378 tcttagaaactgtgattgggtctaatacaactccacaaaatcggcttatgaggtgaggattgcccccacttataaacatattgtcaggcca 14927288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 138 - 256
Target Start/End: Original strand, 17525099 - 17525217
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||| |||||||||||| ||||||  |||||||| ||||||||| ||||||| ||   |||| ||||||||||||||||||| ||| |||| |||    
17525099 cttagaaattgtggttgggcctgacacaattccacaaaaccggcttgtgcggtgaggattcttcccatttataaacacattgtcaggtcatgtcctgtcc 17525198  T
238 gatgtgtgactcttaacac 256  Q
    |||||| |||| |||||||    
17525199 gatgtgagacttttaacac 17525217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 134 - 255
Target Start/End: Complemental strand, 8424976 - 8424855
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||| |||||||| ||||||| || ||||||||||||||||||  || ||||||||||| | ||||||||||||||||| | |||||||| ||| |||||    
8424976 gattattagaaatcgtggttgagcttaacacaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaataaattgtcagaccaactcct 8424877  T
234 atccgatgtgtgactcttaaca 255  Q
    | | |||||| |||| ||||||    
8424876 aactgatgtgggacttttaaca 8424855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 183 - 255
Target Start/End: Complemental strand, 4662270 - 4662198
Alignment:
183 tgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||| ||||||||||||||||||| ||||||||| ||| |||||||||||||| |||||||||||    
4662270 tgtgaggtgaggattgcccccacttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaaca 4662198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 137 - 229
Target Start/End: Complemental strand, 11020643 - 11020551
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatc 229  Q
    |||||||||| | | |||| |||||||||| ||||| ||||||||||||||||||||| ||||| ||||||||||||||||| |||| |||||    
11020643 tcttagaaatcgcgattggacctaacacaatcccactaaatcggcttgtgaggtgaggattgcctccacttataaacacattttcagaccatc 11020551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 156 - 255
Target Start/End: Complemental strand, 15464835 - 15464736
Alignment:
156 gcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||||||  || ||||||||||||| ||||||||||||| | |||||||||||| ||||||| |||  ||||||  ||||||||||    
15464835 gcctaacacaaccccacaaaactggtttgtgaggtgaggattgcccccacttaaatacacattgtcagaccatctcatatttgatgtgaaactcttaaca 15464736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 137 - 220
Target Start/End: Original strand, 36352158 - 36352241
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgt 220  Q
    ||||| |||| |||||||  |||||||||||||||||||| |||||| |||||||| | |||||||||||||||||||||||||    
36352158 tcttaaaaattgtggttgaacctaacacaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacacattgt 36352241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 8227434 - 8227316
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||| | ||||||||| |||||| ||||| |||||| || || || |||||||| |||||||||||||||||||| |  ||| ||||||||  |||    
8227434 tcttagaatttgtggttgggactaacataaccctacaaaaccgcctcgtaaggtgaggattgcccccacttataaacacttgttcatgccatctctcatc 8227335  T
237 cgatgtgtgactcttaaca 255  Q
    | |||||||||||||||||    
8227334 caatgtgtgactcttaaca 8227316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 35418413 - 35418531
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| |||  | |||| |||||||| |||| ||||||||||||||||| |||||||||| |||||| | ||||| | | |||||||||||    
35418413 tcttagaaattgtgattgaacttaacgcaaccccataaaaccggcttgtgaggtgaggattgcccccacctataaatatattgttatgtcatctcctatc 35418512  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||  |||||||||||    
35418513 cgatgtaagactcttaaca 35418531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 159 - 256
Target Start/End: Complemental strand, 24396163 - 24396066
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||||||| || |||||| |||||   || |||| ||||||||||| |||||||||||||||  ||||||||||| ||||||||||||    
24396163 taacacaaccccacaaaaccgacttgtggggtgataattacccctacttataaacatattgtcaggccatcttatatccgatgtgggactcttaacac 24396066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 137 - 218
Target Start/End: Original strand, 33606288 - 33606369
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacatt 218  Q
    |||||||||| ||||||| |||||||| ||| ||||||||  |||||||||||||||| || ||||||||||||||||||||    
33606288 tcttagaaatcgtggttgtgcctaacataacgccacaaaactggcttgtgaggtgaggattacccccacttataaacacatt 33606369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 136 - 211
Target Start/End: Complemental strand, 15988499 - 15988423
Alignment:
136 ttcttagaaatggtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    ||||||||||| ||||||||||| ||||||||||| ||||||  |||||||||||||||| ||||||||||||||||    
15988499 ttcttagaaatcgtggttgggcccaacacaacccccacaaaactggcttgtgaggtgaggattgcccccacttataa 15988423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 15124782 - 15124901
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct-at 235  Q
    |||||||||| ||||||||| ||||||||||||||||||| ||  |||||| |||| | |||||| |||||||||||||| |||||  |||| || | ||    
15124782 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaacacactgtcataccatgtcttaat 15124881  T
236 ccgatgtgtgactcttaaca 255  Q
    | |||||| |||||||||||    
15124882 ctgatgtgagactcttaaca 15124901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 19544370 - 19544456
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcagg 224  Q
    |||||||||| |||||||| ||||||| | | |||||||| ||||||||||||||| | ||||||||||||||||||||||| |||||    
19544370 tcttagaaatcgtggttggacctaacatagctccacaaaaccggcttgtgaggtga-gattgcccccacttataaacacattatcagg 19544456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 16419352 - 16419295
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||    
16419352 tcttagaaatcgtggttgggcctaatacaaccccacaaaaccggcttgtgaggtgagg 16419295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 18607042 - 18607127
Alignment:
171 acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||| |||||| |||||||| | ||| ||||||| |||||||||||||||||||||| |||||| |||||| |||||| |||||    
18607042 acaaaaccggcttttgaggtgatgattgtccccactaataaacacattgtcaggccatcacctatctgatgtgagactctaaacac 18607127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 139 - 223
Target Start/End: Complemental strand, 10523102 - 10523018
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    |||||||| ||||||||||||||||||| |||||||||  |||||| ||||||| | ||| | ||| ||||||||||||||||||    
10523102 ttagaaatcgtggttgggcctaacacaatcccacaaaaatggcttgcgaggtgaagattgtcaccatttataaacacattgtcag 10523018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 10523336 - 10523224
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||  ||||||||| ||||  |||||||||||||   |||||||||||||||  ||  || ||||| |||||||||||||| ||||||| ||||||    
10523336 ttagaaacagtggttgggtctaatgcaaccccacaaaactagcttgtgaggtgaggaatgttcctacttaaaaacacattgtcagaccatctcttatccg 10523237  T
239 atgtgtgactctt 251  Q
    ||||| |||||||    
10523236 atgtgggactctt 10523224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 21383284 - 21383351
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccac--aaaatcggcttgtgaggtgagggttgccccc 203  Q
    ||||||||| |||||||||||||||||||||||||  |||| ||||||||||||||||| ||||||||    
21383284 cttagaaattgtggttgggcctaacacaaccccacaaaaaaccggcttgtgaggtgaggattgccccc 21383351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 181 - 256
Target Start/End: Complemental strand, 15518801 - 15518726
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||| ||| |||||| |||||||||||||||||||||||  || ||||||| ||||| ||||||||||||    
15518801 cttgtgaggttaggattgccctcacttataaacacattgtcaggctgtcacctatccaatgtgggactcttaacac 15518726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 173 - 255
Target Start/End: Complemental strand, 3738982 - 3738900
Alignment:
173 aaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||| ||| |||||| |||||| ||||||||||||||||||||||| ||| | ||||| |||||||||||  |||||||||||    
3738982 aaaaccggtttgtgatgtgaggattgcccccacttataaacacattatcatgtcatcttctatccgatgttggactcttaaca 3738900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 148 - 206
Target Start/End: Original strand, 5450500 - 5450558
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccact 206  Q
    |||||||||||||| |||||||||||||| ||||||||||||||| || ||||||||||    
5450500 gtggttgggcctaagacaaccccacaaaaccggcttgtgaggtgatggctgcccccact 5450558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 207
Target Start/End: Complemental strand, 10571055 - 10570985
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||| ||||||| ||||||||||||||||||||| |||||||| |||||| | ||||| ||||||    
10571055 tcttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaagattgcctccactt 10570985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 135 - 237
Target Start/End: Original strand, 24666230 - 24666331
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| || |||| ||| || |||| | ||||||||||| ||||||||||||| ||||||| ||| ||||||||||| ||||| |||| ||||    
24666230 attcttagaaatcgttgttgagcccaa-acaatctcacaaaatcggtttgtgaggtgaggattgccccaactaataaacacattttcaggtcatcaccta 24666328  T
235 tcc 237  Q
    |||    
24666329 tcc 24666331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 182 - 256
Target Start/End: Original strand, 44403970 - 44404044
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| |||| | |||||| |||||||||||||||| ||| ||||| |||||| |||||||||||||    
44403970 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacac 44404044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 13210611 - 13210534
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    |||||||| | ||||||||||||||||| ||||||||||| || | |||||||||||| |||||| | ||||||||||    
13210611 tcttagaatttgtggttgggcctaacacgaccccacaaaaccgacctgtgaggtgaggattgccctctcttataaaca 13210534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 136 - 217
Target Start/End: Original strand, 30006577 - 30006658
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||||| |||||||||||  |||||||| ||||||| ||||||||| ||||| | ||  ||||||||||||||||||    
30006577 ttcttagaaatcgtggttgggccgtacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30006658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 136 - 217
Target Start/End: Original strand, 30063265 - 30063346
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||||| |||||||||||  |||||||| ||||||| ||||||||| ||||| | ||  ||||||||||||||||||    
30063265 ttcttagaaatcgtggttgggccatacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30063346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 139 - 212
Target Start/End: Complemental strand, 31222604 - 31222531
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaa 212  Q
    |||||||| |||||||| ||||||||||||| |||||||||| || || ||||||| ||||| |||||||||||    
31222604 ttagaaatcgtggttggtcctaacacaaccctacaaaatcggtttatggggtgaggattgcctccacttataaa 31222531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 170 - 255
Target Start/End: Original strand, 40149260 - 40149343
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||| || |||||||||||||  ||||||| ||||||||||||||||| ||| |||||| ||||||||||| |||||||||||    
40149260 cacaaaaccgacttgtgaggtgagaattgcccc-acttataaacacattgttaggtcatctcatatccgatgtg-gactcttaaca 40149343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 139 - 211
Target Start/End: Original strand, 31008572 - 31008644
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||  ||||||| ||||||||||||||||||||| |||| |||||||||||  |||||| |||||||||    
31008572 ttagaaactgtggttgagcctaacacaaccccacaaaaccggcatgtgaggtgagaattgcccacacttataa 31008644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 178 - 242
Target Start/End: Original strand, 44404198 - 44404262
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||||||||||||| | ||||||||||||| ||||| |||||||| ||||| ||||||||||||    
44404198 cggcttgtgaggtgatgattgcccccacttacaaacatattgtcagaccatcacctatccgatgt 44404262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 27897504 - 27897559
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||||||||| ||||||||||||| || |||| |||||||||||||||||    
27897504 ttagaaatggtggttgagcctaacacaacctcataaaaccggcttgtgaggtgagg 27897559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 198 - 256
Target Start/End: Original strand, 14466235 - 14466293
Alignment:
198 gcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||||||||||||| ||||||| |||| |||||||||  |||||||||||    
14466235 gcccccacttataaacacattgttaggccatgtcctgtccgatgtggaactcttaacac 14466293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 93737 - 93793
Alignment:
155 ggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||||||| || || ||||||| ||||||||||||||||| ||||||||||||||||    
93737 ggcctaactcatcctcacaaaaccggcttgtgaggtgaggattgcccccacttataa 93793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 143 - 255
Target Start/End: Original strand, 1926446 - 1926558
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||| ||||||||||| || |||||| ||  ||||||||||||| || |||||||||||||| | ||||||   ||| ||| || || ||||    
1926446 aaatcgtggttgagcctaacacaatcctacaaaaccgatttgtgaggtgaggattacccccacttataaataaattgtctaaccaactcttaaccaatgt 1926545  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
1926546 gggactcttaaca 1926558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 196 - 255
Target Start/End: Original strand, 25313571 - 25313631
Alignment:
196 ttgcccccacttataaa-cacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||| |||||||||||| ||||| |||||| ||||| |||||||||||    
25313571 ttgcccccacttataaaacacattgtcaggtcatctactatccaatgtgggactcttaaca 25313631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 159 - 251
Target Start/End: Complemental strand, 38629904 - 38629812
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||  |||||||| || |||||||| ||||| ||| ||| ||||||||| ||||||||| | ||| || ||||||||||| |||||||    
38629904 taacacaattccacaaaaccgacttgtgagatgaggattgtcccaacttataaatacattgtcatgtcatttcttatccgatgtgagactctt 38629812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 137 - 176
Target Start/End: Original strand, 93626 - 93665
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    |||||||||| |||||||||||||||||||||||||||||    
93626 tcttagaaatcgtggttgggcctaacacaaccccacaaaa 93665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 9153815 - 9153870
Alignment:
134 gattcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgagg 189  Q
    ||||||||||||| ||| ||||||| |||||||||||||| || ||||||||||||    
9153815 gattcttagaaattgtgattgggcccaacacaaccccacataaccggcttgtgagg 9153870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 19544252 - 19544367
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgt--gaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||| ||||||||||| |||||||||| |||||||||   |||  ||||| ||| ||| ||| |||||||||| |||||||||| |||||| ||    
19544252 tcttagaaatcgtggttgggcc-aacacaaccctacaaaatcg---tgtacgaggtaaggattgtccc-acttataaacgcattgtcaggtcatctcata 19544346  T
235 tccgatgtgtgactcttaaca 255  Q
    | | ||||| |||||||||||    
19544347 ttcaatgtgagactcttaaca 19544367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 149 - 226
Target Start/End: Complemental strand, 22127055 - 22126976
Alignment:
149 tggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgccc-ccacttataaacacattgtcaggcc 226  Q
    |||||||||||||| ||||||  |||||||||| |||| ||||||||  ||||| ||||||||||||||||| |||||||    
22127055 tggttgggcctaactcaacccttacaaaatcggtttgtaaggtgaggactgcccaccacttataaacacattttcaggcc 22126976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 21383669 - 21383723
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    |||||||||| ||||||||||||||| ||| ||||||||| ||| ||||||||||    
21383669 tcttagaaatcgtggttgggcctaactcaatcccacaaaaccggtttgtgaggtg 21383723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 93479 - 93520
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    ||||||| ||||||||||||||||| ||||||||||||||||    
93479 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 135 - 219
Target Start/End: Complemental strand, 4431743 - 4431657
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtga---ggtgagggttgcccccacttataaacacattg 219  Q
    |||||||||||||||||||  | |||||| ||||||||||| | || |||| |   ||||||| ||||||||||||||||||||||||    
4431743 attcttagaaatggtggttaagtctaacaaaaccccacaaact-ggtttgtcatcaggtgaggattgcccccacttataaacacattg 4431657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 148 - 236
Target Start/End: Complemental strand, 34515529 - 34515443
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||| ||||||||| |  ||||||| ||||||||| |||||| ||| ||| ||||| ||||||||||| ||  |||||||||||    
34515529 gtggttgggtctaacacaaac--acaaaattggcttgtgaagtgaggattgtcccaacttacaaacacattgttagatcatctcctatc 34515443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 15451454 - 15451498
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtga 187  Q
    |||| ||||||||||||| ||||| ||||||||||||||||||||    
15451454 aaattgtggttgggcctaccacaatcccacaaaatcggcttgtga 15451498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 176
Target Start/End: Original strand, 93353 - 93392
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    ||||| |||| |||||||||||||||||||||||||||||    
93353 tcttaaaaatcgtggttgggcctaacacaaccccacaaaa 93392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 11099669 - 11099716
Alignment:
204 acttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||||||||||| |||||| |||| |||||| |||||||    
11099669 acttataaacacattgtcaggtcatctcttatctgatgtgagactctt 11099716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 15988265 - 15988218
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||| ||||||||||||||||| || |||||||||||||| ||||    
15988265 cacaaaaccggcttgtgaggtgaggatttcccccacttataaaaacat 15988218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 21840401 - 21840323
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacaca 216  Q
    |||||||||| || |||| |  ||||||||| |||||||||||||||| ||||| ||| ||  |||||||||||||||||    
21840401 tcttagaaatcgtagttgtgtttaacacaacgccacaaaatcggcttgggaggttaggatt-accccacttataaacaca 21840323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 139 - 248
Target Start/End: Original strand, 789393 - 789501
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttata--aacacattgtcaggccatctcctatc 236  Q
    |||||||| ||||||||| || |||||||||||||||| || ||   | ||   || |||| ||||||||||  |||||||||||||||||| || ||||    
789393 ttagaaatcgtggttgggtcttacacaaccccacaaaaacgcct---gtggcatggattgctcccacttatataaacacattgtcaggccatttcttatc 789489  T
237 cgatgtgtgact 248  Q
    ||||||| ||||    
789490 cgatgtgagact 789501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 148 - 226
Target Start/End: Original strand, 13296364 - 13296442
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggcc 226  Q
    |||||||| |||||||||||| ||| | |  |  ||||||||||||| || |||||||||||||||| ||| |||||||    
13296364 gtggttggacctaacacaacctcactacactgatttgtgaggtgaggattacccccacttataaacatattatcaggcc 13296442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 215 - 256
Target Start/End: Original strand, 12343686 - 12343727
Alignment:
215 cattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||  ||||||||||||||||||| ||||||||||||    
12343686 cattgtcaaaccatctcctatccgatgtgggactcttaacac 12343727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 176
Target Start/End: Original strand, 30701126 - 30701163
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaa 176  Q
    |||||||| |||||||||| ||||||||||||||||||    
30701126 ttagaaattgtggttgggcttaacacaaccccacaaaa 30701163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 149 - 217
Target Start/End: Complemental strand, 15461047 - 15460979
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||| | |||||||||||||||||||  | |||||||||||| | ||| | |||| |||||||||||    
15461047 tggttgagtctaacacaaccccacaaaactgtcttgtgaggtgatgattggctccacctataaacacat 15460979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 96; Significance: 9e-47; HSPs: 133)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 35772349 - 35772230
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||    
35772349 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatc 35772250  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
35772249 cgatgtgggactcttaacac 35772230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 4113005 - 4113123
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||    
4113005 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcccatc 4113104  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||| ||||||    
4113105 cgatgtgggacttttaaca 4113123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 40079237 - 40079132
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||    
40079237 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatctcctatc 40079138  T
237 cgatgt 242  Q
    ||||||    
40079137 cgatgt 40079132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 2859391 - 2859511
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||||||||||||||||||||||||| |||| || ||||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||    
2859391 tcttagaaatggtggttgggcctaacacaacctcacagaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacctatc 2859490  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||| ||||    
2859491 cgatgtgggactcttatcacc 2859511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 135 - 255
Target Start/End: Original strand, 42586436 - 42586555
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |||||||||||||||||||| ||    
42586436 attcttagaaatcgtggttgggcctaacacaaccccacaaaattggcttgtgaggtgaggattg-ccccacttatatacacattgtcaggccatctctta 42586534  T
235 tccgatgtgtgactcttaaca 255  Q
    ||||||||| |||||||||||    
42586535 tccgatgtgagactcttaaca 42586555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 15986332 - 15986450
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||||| |||||||||||||||||| | | ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
15986332 tcttagaaatggtggttggacctaacacaaccccacaataccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggctatctcctatc 15986431  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||  |||||||||||    
15986432 cgatgtaggactcttaaca 15986450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 52650770 - 52650888
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||    
52650770 tcttagaaattatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtccggccatctcctatc 52650869  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| ||||| |||||    
52650870 cgatgtgggactcctaaca 52650888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 137 - 257
Target Start/End: Complemental strand, 25713478 - 25713358
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||||||||| ||||||||||||| ||||||||  |||||||||||||| | |||||||||||||||||||||||||||| ||||| ||||||    
25713478 tcttagaaatggtggttaggcctaacacaactccacaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatcacctatc 25713379  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||||||||    
25713378 cgatgtgggactcttaacacc 25713358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 51589075 - 51588959
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||| |||    
51589075 ttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccg 51588976  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
51588975 atgtgggactcttaaca 51588959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 17452827 - 17452945
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||| |||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| ||||||||||||||| || ||||    
17452827 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttatc 17452926  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
17452927 cgatgtgggactcttaaca 17452945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 3169849 - 3169732
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||| |||||||| ||| |||||| |||    
3169849 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccg 3169750  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
3169749 atgtgggactcttaacac 3169732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 25145719 - 25145839
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||| ||||| ||||||||||| |||| ||||||    
25145719 tcttagaaatcatggttgggcctaacacaaccccacaaatccggcttgtgaggtgaggattgcccccactaataaatacattgtcaggtcatcacctatc 25145818  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||||||||    
25145819 cgatgtgagactcttaacacc 25145839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 25145484 - 25145603
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||| ||||||| || |||||||||||||| ||||||||||| |||||||||||||||| ||||| ||||||    
25145484 tcttagaaatcgtggttgggtctaacacaacctcacaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcagaccatcacctatc 25145583  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
25145584 cgatgtgagactcttaacac 25145603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 2859626 - 2859744
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||| |||||||| ||||||||||| ||||||| ||||||||||||||||| || |||||||| |||||||||||||||| ||||| ||||||    
2859626 tcttagaaatgatggttggggctaacacaacctcacaaaaccggcttgtgaggtgaggattacccccactaataaacacattgtcagaccatcacctatc 2859725  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
2859726 cgatgtgagactcttaaca 2859744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 139 - 248
Target Start/End: Original strand, 17452680 - 17452789
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||| || |||| |    
17452680 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcttatctg 17452779  T
239 atgtgtgact 248  Q
    ||||| ||||    
17452780 atgtgggact 17452789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 51589309 - 51589192
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||| |||    
51589309 ttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccg 51589210  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
51589209 atgtgggactcttaacac 51589192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 4112539 - 4112659
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| ||||||||||| |||| |||||||||||||||||||| | ||||||| ||||||||||||||||||| ||||| |||| ||    
4112539 tcttagaaatcgtggttgtgcctaacacaatcccataaaatcggcttgtgaggtgatgattgcccctacttataaacacattgtcatgccatgtcctgtc 4112638  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||||||||    
4112639 cgatgtgggactcttaacacc 4112659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 143 - 255
Target Start/End: Complemental strand, 38080683 - 38080572
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| |||||||||||||||||||||||||||||  |||||||||||||||| ||||||| | ||||||||||||||||||||||||||| |||||||||    
38080683 aaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccaa-ttataaacacattgtcaggccatctcccatccgatgt 38080585  T
243 gtgactcttaaca 255  Q
    | |||||||||||    
38080584 gggactcttaaca 38080572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 136 - 255
Target Start/End: Original strand, 20208526 - 20208643
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||||||||||||||||||||||  |||||  |||||||||| |||||||||||||||||||||||||||| |||| ||||||    
20208526 ttcttagaaatcgtggttgggcctaacacaaccccacaaac-cggcta-tgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctat 20208623  T
236 ccgatgtgtgactcttaaca 255  Q
    |||||||| |||||||||||    
20208624 ccgatgtgggactcttaaca 20208643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 139 - 254
Target Start/End: Original strand, 25137304 - 25137419
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| |||||| |||||||||| ||||||  ||||||||||| |||||||||||| |||||| |||    
25137304 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccatacttataaacaaattgtcaggccaactcctaaccg 25137403  T
239 atgtgtgactcttaac 254  Q
    ||||| ||||||||||    
25137404 atgtgggactcttaac 25137419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 26177228 - 26177109
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||||||||||  || || |||||||||| |||||||||||||||||||| |||||||| ||| |||| ||    
26177228 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctgtc 26177129  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||||||||||||    
26177128 cgatgtgggactcttaacac 26177109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 26176993 - 26176875
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| | ||||||||||||||||||||||||||| ||| || |||||||||| |||||| ||||||||| |||||||||||||||| |||| ||    
26176993 tcttagaaatcgcggttgggcctaacacaaccccacaaaaccggtttttgaggtgaggattgccctcacttataagcacattgtcaggccatgtcctgtc 26176894  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
26176893 cgatgtgggactcttaaca 26176875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 39348352 - 39348465
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| ||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||| |||||| |||||||||||||    
39348352 tcttagaaatcgtg-ttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaacacgttgtcaagccatctcctatc 39348450  T
237 cgatgtgtgactctt 251  Q
     ||||||| ||||||    
39348451 tgatgtgttactctt 39348465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 41035826 - 41035944
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| || ||||| |||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |||| |||||||| |||||||    
41035826 tcttagaaatcgtagttggacctaacacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattggcaggccatgtcctatc 41035925  T
237 cgatgtgtgactcttaaca 255  Q
    ||| ||| |||||||||||    
41035926 cgacgtgagactcttaaca 41035944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 136 - 257
Target Start/End: Original strand, 39348117 - 39348238
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| ||||||||| |||||||||||||||| || ||||| || || ||||| ||||| |||||||||||||||||||||||| |||||||||    
39348117 ttcttagaaatcgtggttgggtctaacacaaccccacagaaccggctggtaagttgaggattgcctccacttataaacacattgtcaggctatctcctat 39348216  T
236 ccgatgtgtgactcttaacacc 257  Q
    |||||||| ||||||| |||||    
39348217 ccgatgtgggactcttcacacc 39348238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 140 - 256
Target Start/End: Complemental strand, 52961664 - 52961548
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    |||||||  ||||||| ||||||||||||||| |||| |||||| |||||||||| |||||| ||||||||||||||||||||| |||||||||||||||    
52961664 tagaaatcatggttggacctaacacaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccga 52961565  T
240 tgtgtgactcttaacac 256  Q
    |||| ||| ||||||||    
52961564 tgtgggacacttaacac 52961548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 139 - 233
Target Start/End: Complemental strand, 51589889 - 51589795
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcct 233  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||    
51589889 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcct 51589795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 137 - 253
Target Start/End: Complemental strand, 16163018 - 16162902
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||| | ||||||||||||||||||||||| || |||||||||| ||| ||||||||| |||||||||||||||||||| | ||||    
16163018 tcttaaaaattgtggttgagtctaacacaaccccacaaaatcggtttatgaggtgaggtttgtccccacttaaaaacacattgtcaggccatcacatatc 16162919  T
237 cgatgtgtgactcttaa 253  Q
    ||||||| |||||||||    
16162918 cgatgtgagactcttaa 16162902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 26173457 - 26173573
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||||| ||||||||| |||||||||||||||||||| ||||||   |||||||  |||||||||||||||||||||||||||| ||||||| |||| |    
26173457 ttagaaagggtggttggacctaacacaaccccacaaaaccggcttacaaggtgagaattgcccccacttataaacacattgtcagaccatctcatatctg 26173556  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
26173557 atgtgggactcttaaca 26173573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 38733468 - 38733348
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| || |||||||||||||||||| ||||||| |||| | |||||||||| |||||| |||||||||||| |||||||| ||||| | |||    
38733468 ttcttagaaatcgttgttgggcctaacacaacctcacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatat 38733369  T
236 ccgatgtgtgactcttaacac 256  Q
    |||||||| ||||||||||||    
38733368 ccgatgtgggactcttaacac 38733348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 31181511 - 31181618
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||| | |||||||||||||||||||||||| |||| | ||||||||||||||| ||||||||||||||||||||||  |||||||||||| |||    
31181511 ttcttagaatttgtggttgggcctaacacaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttat 31181610  T
236 ccgatgtg 243  Q
    || |||||    
31181611 ccaatgtg 31181618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 16163254 - 16163133
Alignment:
137 tcttagaaatggtggttgggcctaacaca--accccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||| |||| |||||||||||||||| |  ||||||||||| ||| ||||||||||| | ||||||||||||||||||||||||||| | |||| ||||    
16163254 tcttaaaaattgtggttgggcctaacatataaccccacaaaaccggattgtgaggtgaagattgcccccacttataaacacattgtcaagtcatcaccta 16163155  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||| ||||||||||||    
16163154 tccgatgtgggactcttaacac 16163133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 26865357 - 26865475
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||| |||||| |||||||||||||| |||||||||||||| || ||||||||||||||||| ||||||||||| ||| || | ||    
26865357 tcttagaaattgtggttgagcctaatacaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaatacattgtcaggtcatgtcttgtc 26865456  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| ||| |||||||    
26865457 cgatgtgggacacttaaca 26865475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 30369920 - 30369802
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||||||||||||||||||||    |||||||||||||| ||||||| ||||||||||| |||||| | ||||||| ||||    
30369920 tcttagaaatcgtggttgggcctaacacaaccccacaaaactatcttgtgaggtgaggattgcccctacttataaacatattgtcggaccatctcatatc 30369821  T
237 cgatgtgtgactcttaaca 255  Q
    |||||||  ||||||||||    
30369820 cgatgtggaactcttaaca 30369802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 4098162 - 4098282
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| | ||||||| ||| |||||| | |||| |||||||||||||||||||||| ||||| | ||||| |||     
4098162 tcttagaaattgtggttgggcctaacacaatcacacaaaaccggtttgtgaagagaggattgcccccacttataaacacatcgtcagacgatctcatatt 4098261  T
237 cgatgtgtgactcttaacacc 257  Q
    ||||||| |||||||||||||    
4098262 cgatgtgagactcttaacacc 4098282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 136 - 256
Target Start/End: Original strand, 51459703 - 51459823
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||| |||||||||||||| |||| ||||||||| | |||||| || || || ||||||||||||||||||||||||| |||| ||| |||||    
51459703 ttcttagaaattgtggttgggcctaatacaatcccacaaaaccagcttgtaagatgcggattgcccccacttataaacacattgttaggctatcacctat 51459802  T
236 ccgatgtgtgactcttaacac 256  Q
    ||||| || ||||||||||||    
51459803 ccgatatgggactcttaacac 51459823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 856066 - 855947
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||  || |||||||||||||||| | ||||||| | ||||||||||||||| ||| |||||| |||||||||||||||||||||| |||||||    
856066 tcttagaaaacgtagttgggcctaacacaatctcacaaaaccagcttgtgaggtgaggattgtccccacgtataaacacattgtcaggccatgtcctatc 855967  T
237 cgatgtgtgactcttaacac 256  Q
    || ||||  |||||||||||    
855966 cggtgtggaactcttaacac 855947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 35772114 - 35772002
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||| |||||| |||||      ||||||||||| |||||||||||    
35772114 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccacactt------acattgtcaggtcatctcctatc 35772021  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
35772020 tgatgtgagactcttaaca 35772002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 35892376 - 35892257
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||| |||||||| |||||||||||| ||| ||||||||||||  ||||||||||||||||| |||||||||| ||||||  ||||    
35892376 tcttagaaattatggttgagcctaacagaaccccacaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatc 35892277  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
35892276 tgatgtgggactcttaacac 35892257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 138 - 256
Target Start/End: Original strand, 4098403 - 4098520
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||| |||||||||||||||||||||| |||||| |  ||||| |||||||| ||||||||||||||||||||||| |||  ||||||  |||||    
4098403 cttagaaatcgtggttgggcctaacacaaccc-acaaaaccaacttgtaaggtgaggattgcccccacttataaacacattatcaaaccatctattatcc 4098501  T
238 gatgtgtgactcttaacac 256  Q
    |||||| ||||||||||||    
4098502 gatgtgcgactcttaacac 4098520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 8870909 - 8870995
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||  ||||||| ||||||||||||||||||||    
8870909 tcttagaaatggtggttggacctaacacaaccccacaaaaacggcttatgaggtgagaattgccccaacttataaacacattgtcag 8870995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 43409891 - 43409774
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| | |||||||||||| ||||| ||||||||||||||||  ||| ||||||||||||| |||||||||| |||| | |||||    
43409891 tcttagaaatcgtggttggacataacacaaccccccaaaaccggcttgtgaggtgagaattg-ccccacttataaatacattgtcagaccatgttctatc 43409793  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
43409792 cgatgtgagactcttaaca 43409774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 137 - 222
Target Start/End: Complemental strand, 38668210 - 38668125
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    |||||||||| ||| |||||||||||||||||||||||||| |||||||||| ||| | |||||||||||||||||||||||||||    
38668210 tcttagaaattgtgattgggcctaacacaaccccacaaaattggcttgtgagatgatgattgcccccacttataaacacattgtca 38668125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 143 - 255
Target Start/End: Complemental strand, 11925000 - 11924888
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||| ||||||||||||||||||||| ||||||| ||| |||| |||||||   | |||||||||||||||| |||||||| ||||| ||||||||||||    
11925000 aaatcgtggttgggcctaacacaacctcacaaaaccggtttgtaaggtgagaaatacccccacttataaacatattgtcagaccatcacctatccgatgt 11924901  T
243 gtgactcttaaca 255  Q
    || ||||||||||    
11924900 gtaactcttaaca 11924888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 151 - 255
Target Start/End: Original strand, 12244975 - 12245079
Alignment:
151 gttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    ||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||| ||| ||| ||||||  ||||||  ||||||    
12244975 gttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgccagaccaactcctaatcgatgtaggactct 12245074  T
251 taaca 255  Q
    |||||    
12245075 taaca 12245079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 152 - 256
Target Start/End: Complemental strand, 38668430 - 38668326
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||||| ||||||||| || ||||| |||||| | |||||||||||||||||||||||||||  ||||| | ||||||||||| |||||||    
38668430 ttgggcctaacacaatcccacaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatcacatatccgatgtgggactctt 38668331  T
252 aacac 256  Q
    |||||    
38668330 aacac 38668326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 49143038 - 49142958
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||||||||||||||| |||||||| |||||||||| |||||||||| ||||| ||||||||||||||||||||||    
49143038 tcttagaaatggtggttgggcataacacaatcccacaaaattggcttgtgagctgaggattgcccccacttataaacacat 49142958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 52127803 - 52127688
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| |||||||| |||||||||||||||||||| | ||||||||||||||| ||| ||||||||||||||| ||| | ||| || |||||| |||    
52127803 ttagaaatcgtggttggacctaacacaaccccacaaaagcagcttgtgaggtgaggattg-ccccacttataaacaaattcttaggtcaactcctaaccg 52127705  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
52127704 atgtgggactcttaaca 52127688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 7653561 - 7653442
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||| ||||||||||| |||| |||||| ||| |||||||||| |||||||| || || |||| ||||| |||     
7653561 tcttagaaattgtggttgggcctaacacaatcccacaaaatcagcttctgaggtaaggattgcccccacgtataaacaaatcgtgaggctatctcttatt 7653462  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| ||| ||||||||    
7653461 cgatgtgggacgcttaacac 7653442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 136 - 251
Target Start/End: Original strand, 21626337 - 21626452
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctat 235  Q
    ||||||||||  |||||||||||||| ||| |||||||||| ||| || ||| |||||| | ||||||||||||||||| |||||||||||||||| |||    
21626337 ttcttagaaactgtggttgggcctaaaacagccccacaaaaccggattttgaagtgaggatggcccccacttataaacatattgtcaggccatctcttat 21626436  T
236 ccgatgtgtgactctt 251  Q
    | |||||| |||||||    
21626437 ctgatgtgggactctt 21626452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 27413432 - 27413313
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||| ||| | ||| ||||| |||||||| |||| ||||  |||||    
27413432 tcttagaaatcgtggttggacctaacacaacctcacaaaatcggcttgtgaggtgaggattgtctccagttatacacacattgccaggacatcgtctatc 27413333  T
237 cgatgtgtgactcttaacac 256  Q
    | ||||| |||| |||||||    
27413332 caatgtgggacttttaacac 27413313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 27413667 - 27413548
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  |||||| ||||||||||||| || |||| ||  ||||||||||||| ||||| ||||||||||||| |||||||||||||| |||||     
27413667 tcttagaaatcatggttgagcctaacacaacctcataaaaccgatttgtgaggtgaggattgcctccacttataaacatattgtcaggccatcacctatg 27413568  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||| |||| |||||||    
27413567 cgatgtgggacttttaacac 27413548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 25255396 - 25255279
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||  ||| |  ||||| ||||||||||||  | ||||||| |||     
25255396 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgagaattgtcatcactt-taaacacattgtttgaccatctcttatt 25255298  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
25255297 cgatgtgagactcttaaca 25255279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 152 - 256
Target Start/End: Complemental strand, 3170071 - 3169966
Alignment:
152 ttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttat-aaacacattgtcaggccatctcctatccgatgtgtgactct 250  Q
    ||||| ||||||||||||||||||| ||||||||||||| ||| |||||| ||||||| ||||| |||||||| ||| |||||| |||||||| ||||||    
3170071 ttgggtctaacacaaccccacaaaaccggcttgtgaggtaaggattgccctcacttataaaacaaattgtcagaccaactcctaaccgatgtgggactct 3169972  T
251 taacac 256  Q
    ||||||    
3169971 taacac 3169966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 489 - 576
Target Start/End: Original strand, 27254330 - 27254417
Alignment:
489 cttttagaagataaatgaggttttaatcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtctatccaaaacagaagtca 576  Q
    ||||||| |||||||| |||| |||||||||||||||||||| |||||||||||||| |||||||| || ||||||||| ||||||||    
27254330 cttttagtagataaatcaggtgttaatcttgcttcaccaacataacctaaaccagaatcaggtgcaagtttatccaaaatagaagtca 27254417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 137 - 243
Target Start/End: Original strand, 3477175 - 3477281
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||| ||| |||||| ||||||||||| |||||| || |||||| ||| | ||||||||||||||||||||| ||||| ||||||||||     
3477175 tcttagaaatcgtgattgtgcctaatacaaccccacacaatcgggttatgaggtaaggatcgcccccacttataaacacattatcaggacatctcctatt 3477274  T
237 cgatgtg 243  Q
    |||||||    
3477275 cgatgtg 3477281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 142 - 255
Target Start/End: Original strand, 28408043 - 28408159
Alignment:
142 gaaatggtggttgggcctaac---acaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    ||||| ||||||||||||| |   |||||||||||||| ||||||||||||| ||| ||| ||||||||||||||| |||||||| ||| || ||| |||    
28408043 gaaatcgtggttgggcctagcctaacaaccccacaaaaccggcttgtgaggtaaggattgtccccacttataaacaaattgtcagaccaacttctaaccg 28408142  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
28408143 atgtgggactcttaaca 28408159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 148 - 254
Target Start/End: Complemental strand, 39808539 - 39808434
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgac 247  Q
    |||||||||||||||||| |||||||||| ||| ||| | ||||||| ||| |||||||||||||||||||||||| ||||| | ||||| ||||| |||    
39808539 gtggttgggcctaacacagccccacaaaaccggtttggg-ggtgaggattgtccccacttataaacacattgtcagaccatcacatatccaatgtgggac 39808441  T
248 tcttaac 254  Q
    |||||||    
39808440 tcttaac 39808434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 174 - 256
Target Start/End: Original strand, 51459866 - 51459948
Alignment:
174 aaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| ||||| | |||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||    
51459866 aaatgggcttttaaggtgaggattgcccccacttataaacacattgttaggccatcacctatccgatgtgggactcttaacac 51459948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 139 - 256
Target Start/End: Complemental strand, 51590121 - 51590006
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||| ||||||||||||||| ||||||||| ||||||||||||||||| |||  | |||||||||||| |||||||| | | |||||| | |    
51590121 ttagaaatcgtgcttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattg--ctcacttataaacaaattgtcagacaaactcctaactg 51590024  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
51590023 atgtgggactcttaacac 51590006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 135 - 223
Target Start/End: Original strand, 26173227 - 26173309
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||||||||||||||||||||||||||      |||||||| ||||||||||||||| | ||||||||||||||||||||||||||||    
26173227 attcttagaaatggtggttgggcctaac------ccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcag 26173309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 137 - 245
Target Start/End: Complemental strand, 32223848 - 32223740
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||||| ||||||||||||| ||  |||||||||| ||||| | |||||||| |||||||||||  |||||||||||  ||||    
32223848 tcttagaaattgtggttgggccttacacaaccccacacaactggcttgtgagatgaggatcgcccccacatataaacacatgttcaggccatcttttatc 32223749  T
237 cgatgtgtg 245  Q
    | |||||||    
32223748 ctatgtgtg 32223740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 181 - 256
Target Start/End: Original strand, 8870732 - 8870807
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||| |||||||||||||||||||||||||||  ||||| || |||||||||| ||||||||||||    
8870732 cttgtgaggtgaggattgcccccacttataaacacattgtcacaccatcaccgatccgatgtgggactcttaacac 8870807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 31432229 - 31432295
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc 203  Q
    |||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||    
31432229 tcttagaaatcgtggttgggcctagcacaaccccacaaaaccggcttgtgaggtgaggattgccccc 31432295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 137 - 223
Target Start/End: Complemental strand, 49142593 - 49142507
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    |||||||||||||||||| ||||||||||| |||||| | ||| ||||||||||| || |||||| ||||| |||||||||||||||    
49142593 tcttagaaatggtggttgagcctaacacaatcccacatattcgacttgtgaggtggggattgccctcacttctaaacacattgtcag 49142507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 139 - 217
Target Start/End: Complemental strand, 52907467 - 52907389
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||| || ||||||||| || |||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||    
52907467 ttagatatcgtggttgggtcttacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 52907389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 173 - 256
Target Start/End: Original strand, 4112805 - 4112889
Alignment:
173 aaaatcggcttgtgaggtgagggttgcccc-cacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| ||| ||||||||||||| || |||| |||||||||||||||||||||||||| ||| |||||||||| ||||||||||||    
4112805 aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaacac 4112889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 139 - 239
Target Start/End: Complemental strand, 9499328 - 9499229
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| | | ||||||||||||||||| ||| ||||||||||| | ||||||| ||||||||||| |||||||| | ||||||||||||    
9499328 ttagaaatcgtggttgagtcgaacacaaccccacaaaaccgg-ttgtgaggtgaagattgcccctacttataaacatattgtcagactatctcctatccg 9499230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 17468419 - 17468315
Alignment:
148 gtggttgggcctaacacaacccc-acaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtga 246  Q
    ||||||||||| ||||||||||| ||| ||  | || ||||| ||||| ||||||||||||||||||| |||||||| ||||||| ||||||||||| ||    
17468419 gtggttgggcccaacacaacccccacataacggactggtgagatgaggattgcccccacttataaacatattgtcagaccatctcttatccgatgtggga 17468320  T
247 ctctt 251  Q
    |||||    
17468319 ctctt 17468315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 135 - 255
Target Start/End: Complemental strand, 32952158 - 32952038
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    ||||||| |||| |||||||| ||||||||||||| | |||| || |||||||||  ||| ||| | |||||||||||||||||||||  ||| ||||||    
32952158 attcttataaatagtggttggacctaacacaacccaaaaaaaccgacttgtgagggaaggattggctccacttataaacacattgtcaaaccaactccta 32952059  T
235 tccgatgtgtgactcttaaca 255  Q
    ||| ||||| || ||||||||    
32952058 tccaatgtgggattcttaaca 32952038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 7307806 - 7307687
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||| ||||||||| || || |||||| || |||||||||||||  ||||| ||||||||||||||||||| ||| |||||  | ||    
7307806 tcttagaaattatggttaggcctaacataatccaacaaaaccgacttgtgaggtgagaattgcctccacttataaacacattgttaggtcatcttatgtc 7307707  T
237 cgatgtgtgactcttaacac 256  Q
    ||||||  ||||||||||||    
7307706 cgatgttggactcttaacac 7307687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 461 - 576
Target Start/End: Original strand, 27294425 - 27294540
Alignment:
461 gaaggaatttgtgtagcaaggagctgtacttttagaagataaatgaggttttaatcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtcta 560  Q
    |||||||  |||||| ||||||  ||| ||||||| |||||||| |||| |||||||||||||||||||| ||||||||||| || | |||||| || ||    
27294425 gaaggaacatgtgtaccaaggaattgtccttttagtagataaatcaggtgttaatcttgcttcaccaacataacctaaaccacaatccggtgcaagttta 27294524  T
561 tccaaaacagaagtca 576  Q
     |||||| ||||||||    
27294525 cccaaaatagaagtca 27294540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 136 - 215
Target Start/End: Complemental strand, 29898998 - 29898919
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||| ||||||||||||| ||||||| ||||||| ||||||||| ||||||  |||||| |||||||||||||    
29898998 ttcttagaaatcgtggttgggcctagcacaacctcacaaaaccggcttgtgtggtgagaattgccctcacttataaacac 29898919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 17402667 - 17402549
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||| |||||||||||||||| || ||| |  ||| |||||||| | |||||| ||||| |||||| |||||||| ||||| ||||||    
17402667 tcttaaaaatcgtggtcgggcctaacacaaccctacgaaacccacttttgaggtgaagattgcccgcacttttaaacaaattgtcagaccatcacctatc 17402568  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| ||||| |||||    
17402567 cgatgtgggactcataaca 17402549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 207
Target Start/End: Complemental strand, 29266038 - 29265968
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt 207  Q
    |||||||||| ||||||||||||||||||||||||||||| | |||||| |||||||  ||||||||||||    
29266038 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaaggtgagtattgcccccactt 29265968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 137 - 203
Target Start/End: Complemental strand, 33156818 - 33156752
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgccccc 203  Q
    |||||||||| ||||||||||||||||||||||||||||| ||| ||||||| ||||| ||||||||    
33156818 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagatgaggattgccccc 33156752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 139 - 217
Target Start/End: Original strand, 40316051 - 40316129
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| ||||||||  ||||||||||| ||||||| |||||| |||||||||| ||| ||||||||||||||||||    
40316051 ttagaaatcgtggttggatctaacacaacctcacaaaaccggcttatgaggtgaggattgaccccacttataaacacat 40316129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 135 - 217
Target Start/End: Original strand, 42351857 - 42351939
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||||||  |||||||||| |||||||| ||||||||  |||||||||||||||| | ||| ||||||||||||||||    
42351857 attcttagaaatcatggttgggcccaacacaacaccacaaaactggcttgtgaggtgaggatggcctccacttataaacacat 42351939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 148 - 217
Target Start/End: Original strand, 31004447 - 31004516
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||||| ||||| |||||| |||||| | ||||||||||||||| ||||||||||||||||||||||    
31004447 gtggttgggtctaacgcaacccaacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 31004516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 34264710 - 34264823
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatcc 237  Q
    ||||||||| |||||||| |||| |||||| | ||||||  | |||||||| || || ||  |||||||||||||||||||||||| || |||||||||     
34264710 cttagaaatcgtggttggacctagcacaactctacaaaactgacttgtgagatgtggattatccccacttataaacacattgtcagaccgtctcctatct 34264809  T
238 gatgtgtgactctt 251  Q
     |||||||||||||    
34264810 catgtgtgactctt 34264823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 232
Target Start/End: Complemental strand, 11234290 - 11234206
Alignment:
148 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcc 232  Q
    |||||||||||||| |||||||||||||| |||||| |||||||||   || |||||||||||||||| |  |||||||||||||    
11234290 gtggttgggcctaatacaaccccacaaaaccggcttatgaggtgagaactgtccccacttataaacacttgttcaggccatctcc 11234206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 255
Target Start/End: Complemental strand, 26603495 - 26603395
Alignment:
155 ggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    ||||||| | |||||||||||| |||||| |||||||||| |||  ||   ||||||||| |||||||| ||||||||||| ||||||| ||||||||||    
26603495 ggcctaatataaccccacaaaaccggcttatgaggtgaggattgtaccattttataaacatattgtcagaccatctcctattcgatgtgagactcttaac 26603396  T
255 a 255  Q
    |    
26603395 a 26603395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 170 - 256
Target Start/End: Complemental strand, 17412619 - 17412533
Alignment:
170 cacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||||||||||||| ||||   | |||  |||||||||||||||||||||| ||||||||||| |||||| |||| |||||||    
17412619 cacaaaatcggcttgtgaagtgaatatcgccatcacttataaacacattgtcaggtcatctcctatctgatgtgggacttttaacac 17412533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 26346968 - 26347053
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    |||||||||| |||||  ||| ||||||||||||||||||  |||||||||||||||| ||| | |||||||||||||||| |||||    
26346968 tcttagaaatcgtggtgaggc-taacacaaccccacaaaacgggcttgtgaggtgaggattgtctccacttataaacacatcgtcag 26347053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 38733236 - 38733119
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||  |||||||||| | ||||||| || |||||||| ||||  ||| ||| |||||||||||||||||||| ||||| | |||     
38733236 tcttagaaatcgtggttgaacctaacacaatctcacaaaaccgacttgtgagatgagaattgtccc-acttataaacacattgtcagaccatcacatatt 38733138  T
237 cgatgtgtgactcttaaca 255  Q
    |||||||  ||||||||||    
38733137 cgatgtggaactcttaaca 38733119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 256
Target Start/End: Original strand, 51460130 - 51460200
Alignment:
187 aggtgagggttgcccc-cacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||||||| || |||| |||||||||||||||||| |||||||| ||||||||||||| ||||||||||||    
51460130 aggtgaggattaccccacacttataaacacattgttaggccatcacctatccgatgtgggactcttaacac 51460200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 181 - 254
Target Start/End: Complemental strand, 369676 - 369603
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    ||||| |||||||| ||||||||||||||||||||||| |||| | |||||||  |||||||| ||||||||||    
369676 cttgtaaggtgaggattgcccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac 369603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 178 - 251
Target Start/End: Original strand, 7826071 - 7826144
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||||| ||| ||| |||||||||||||||||||||||| ||||||  ||| ||||||| |||||||    
7826071 cggcttgtgaggtaaggattgtccccacttataaacacattgtcagaccatcttttattcgatgtgggactctt 7826144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 186 - 254
Target Start/End: Complemental strand, 17412372 - 17412304
Alignment:
186 gaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    |||||| || ||| ||||||||||||||||||| |||| | ||||||||||||||||| ||||||||||    
17412372 gaggtgcggattgtccccacttataaacacattatcagacaatctcctatccgatgtgagactcttaac 17412304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 33157306 - 33157230
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    |||||||||| ||| ||||||||||||||||||||||||| || |||  |||||| || ||| ||||||||||||||    
33157306 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccgacttacgaggtggggattgtccccacttataaac 33157230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 154 - 249
Target Start/End: Original strand, 9146570 - 9146665
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactc 249  Q
    |||||||||||||||| |||||| ||  ||||||||||||| ||||||||| ||||| ||||||  |||| ||||||  | ||||||||| |||||    
9146570 gggcctaacacaacccaacaaaaccgttttgtgaggtgaggattgcccccagttatatacacatgttcagaccatcttttgtccgatgtgggactc 9146665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 149 - 228
Target Start/End: Complemental strand, 17402787 - 17402708
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccat 228  Q
    |||| ||| ||||| ||| |||| |||| ||| || |||||||||| ||||||||||||||||||| |||||||||||||    
17402787 tggtcgggtctaacgcaatcccaaaaaaccggattttgaggtgaggattgcccccacttataaacaaattgtcaggccat 17402708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 212
Target Start/End: Complemental strand, 22377617 - 22377542
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaa 212  Q
    |||||||||| ||||||||| |||||| |||| ||||||| || |||| ||||||| | |||||||||||||||||    
22377617 tcttagaaatcgtggttgggactaacataaccgcacaaaaccgacttgcgaggtgatgattgcccccacttataaa 22377542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 205 - 256
Target Start/End: Complemental strand, 33156986 - 33156935
Alignment:
205 cttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||||||||| |||||||||||||||||||  |||||||||||    
33156986 cttataaacacattgtcagaccatctcctatccgatgtggaactcttaacac 33156935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 215
Target Start/End: Complemental strand, 11525082 - 11525004
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||||| |||| |||||||||||||||| ||||||| ||| ||||| ||||||  |||||||  |||||||||||    
11525082 tcttagaaattgtggatgggcctaacacaacctcacaaaaccggattgtggggtgagcattgcccctgcttataaacac 11525004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 136 - 214
Target Start/End: Original strand, 40188983 - 40189061
Alignment:
136 ttcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    ||||||||| | |||||||||||| |||||||||||||||| || |||||||| |||||  | |||| |||||||||||    
40188983 ttcttagaatttgtggttgggcctgacacaaccccacaaaaccgacttgtgagttgaggacttcccctacttataaaca 40189061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 41067024 - 41066944
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||| |||| |||||||||||||| |||| |||||| || ||| ||||||||||| | || || ||||||||||||||||    
41067024 tcttataaattgtggttgggcctaaaacaagcccacacaaccggtttgtgaggtgaagattacctccacttataaacacat 41066944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 213
Target Start/End: Original strand, 50695833 - 50695909
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaac 213  Q
    |||||||| | ||| || |||||||| ||||||||||||| ||||||||||| ||||| || ||| |||||||||||    
50695833 tcttagaatttgtgcttaggcctaactcaaccccacaaaaccggcttgtgagctgaggattaccctcacttataaac 50695909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 139 - 215
Target Start/End: Original strand, 51460443 - 51460519
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||  ||||||||||||||||||||||||||||  ||||||| | |||| | || || ||||||||||||||    
51460443 ttagaaattatggttgggcctaacacaaccccacaaaactggcttgtaaagtgaagattaccaccacttataaacac 51460519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 12488987 - 12489070
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||||||||||| |||||| | |||||| |||| | |||  || ||||||||||| ||||||||| ||||||||||| |||||    
12488987 taacacaaccccataaaatcagtttgtgaagtgatgattgttccgacttataaacatattgtcaggtcatctcctatctgatgt 12489070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 188 - 255
Target Start/End: Complemental strand, 13386282 - 13386215
Alignment:
188 ggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||| || |||| ||||||| |||||||| |||||||| ||||||||||||||  ||||||||||    
13386282 ggtgaggattaccccaacttatatacacattgccaggccatgtcctatccgatgtggaactcttaaca 13386215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 251
Target Start/End: Complemental strand, 9830644 - 9830546
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca-----ggccatctcctatccgatgtgtgactctt 251  Q
    ||||||||||| || |||||||||||||||| ||||| ||||||  |||||| || ||||||| |     ||||||||| ||||||||||| |||||||    
9830644 ctaacacaacctcataaaatcggcttgtgagctgaggattgcccttacttatcaaaacattgttatgttaggccatctcttatccgatgtgggactctt 9830546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 32783280 - 32783397
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||  |||||| ||  ||| ||||   ||||||||| ||| | |||||||| |||||||||||| |||||  ||||||  ||||    
32783280 tcttagaaatcgtggttggatctaacaaaattccataaaactagcttgtgagatgaagattgcccccgcttataaacaca-tgtcaaaccatctattatc 32783378  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
32783379 cgatgtgagactcttaaca 32783397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 255
Target Start/End: Complemental strand, 33156455 - 33156405
Alignment:
205 cttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    |||||||||||||||||||| ||||||| || ||||||| |||||||||||    
33156455 cttataaacacattgtcaggtcatctccaatacgatgtgggactcttaaca 33156405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 256
Target Start/End: Original strand, 51460243 - 51460325
Alignment:
174 aaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    |||| ||||| | |||||| | ||||||| ||||||||||||||||| ||| |||| |||||| |||||  ||||||||||||    
51460243 aaatgggcttttaaggtgatgattgcccctacttataaacacattgttaggtcatcacctatctgatgttggactcttaacac 51460325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 218
Target Start/End: Complemental strand, 5109569 - 5109488
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacatt 218  Q
    |||||||||| |||| ||||||||||||||   ||||||| |  |||||||||||||| || | || |||||||||||||||    
5109569 tcttagaaattgtggatgggcctaacacaatatcacaaaacccacttgtgaggtgaggattacaccgacttataaacacatt 5109488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 7465685 - 7465722
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||||||||||| ||||||||||||||||||||    
7465685 cggcttgtgaggtgaggattgcccccacttataaacac 7465722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 204 - 257
Target Start/End: Complemental strand, 7652336 - 7652283
Alignment:
204 acttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacacc 257  Q
    |||||||||||||||||||| ||||||  ||||||||||  |||||||||||||    
7652336 acttataaacacattgtcagaccatcttttatccgatgtaagactcttaacacc 7652283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 9146863 - 9146940
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaaca 214  Q
    ||||||||||  |||||| || || |||||| |||||||| |||||||||||| |||| ||| |||| ||||||||||    
9146863 tcttagaaattatggttgagcgtagcacaactccacaaaaccggcttgtgaggagaggattgaccccgcttataaaca 9146940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 138 - 215
Target Start/End: Complemental strand, 11525296 - 11525219
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    ||||||||| || | |||||||||||||||| ||||||| ||| ||||| ||||||  |||||||  |||||||||||    
11525296 cttagaaattgttgatgggcctaacacaacctcacaaaaccggattgtggggtgagcattgcccctgcttataaacac 11525219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 185 - 242
Target Start/End: Original strand, 40524698 - 40524755
Alignment:
185 tgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||||| | ||||||||||||||||||||| |||||| ||||||| ||| ||||||    
40524698 tgaggtgaagattgcccccacttataaacacactgtcagaccatctcatattcgatgt 40524755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 211
Target Start/End: Original strand, 5953201 - 5953269
Alignment:
143 aaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataa 211  Q
    |||| ||||||| |||||||||||||  ||||||||| ||||||||| |||| ||| || |||||||||    
5953201 aaattgtggttgagcctaacacaaccttacaaaatcgacttgtgaggagaggattgtcctcacttataa 5953269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 12376673 - 12376729
Alignment:
138 cttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    ||||||||| || ||||| |||||| |||||||| |||| |||||||||||||||||    
12376673 cttagaaatcgtcgttggacctaactcaaccccataaaaacggcttgtgaggtgagg 12376729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 38739708 - 38739656
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtg 191  Q
    |||||||| || |||| |||||||||||| |||||||| ||||||||||||||    
38739708 ttagaaatcgtagttgagcctaacacaacaccacaaaaccggcttgtgaggtg 38739656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 212
Target Start/End: Complemental strand, 39544479 - 39544406
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaa 212  Q
    ||||||||||||||||||||||  |||||||||||||||| |  ||||| | |||||| ||| ||||| |||||||    
39544479 tcttagaaatggtggttgggcc--acacaaccccacaaaaccaacttgtaaagtgaggattgtccccatttataaa 39544406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 16173283 - 16173210
Alignment:
142 gaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||| ||||||| | ||||||||||||| |||| ||||| ||||||||||| ||||| || |||||||||||||    
16173283 gaaatgatggttgg-cttaacacaacccca-aaaaccggctagtgaggtgaggattgcctccgcttataaacacat 16173210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 136 - 171
Target Start/End: Original strand, 20208227 - 20208262
Alignment:
136 ttcttagaaatggtggttgggcctaacacaacccca 171  Q
    ||||||||||| ||||||||||||||||||||||||    
20208227 ttcttagaaatcgtggttgggcctaacacaacccca 20208262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 5953497 - 5953539
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgccc 201  Q
    |||||||||| ||||||||||||| ||||||||||| ||||||    
5953497 taacacaacctcacaaaatcggctcgtgaggtgaggattgccc 5953539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 223
Target Start/End: Complemental strand, 7653326 - 7653241
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| ||| ||| |||||||||||  |||||| | | ||||||||||||||| ||| |||||||| |||||| ||||||||    
7653326 tcttaaaaattgtgattgagcctaacacaaatccacaagaccagcttgtgaggtgaggattg-ccccacttttaaacaaattgtcag 7653241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 150 - 200
Target Start/End: Original strand, 17557720 - 17557770
Alignment:
150 ggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcc 200  Q
    ||||||||||||| |||||  |||||||| |||||| ||||||||||||||    
17557720 ggttgggcctaactcaaccttacaaaatcagcttgtaaggtgagggttgcc 17557770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 223
Target Start/End: Original strand, 21427102 - 21427188
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcag 223  Q
    ||||| |||| || |||| ||||| |||||  ||| ||||| |||||||||||||||  || | | |||||||||||||||||||||    
21427102 tcttaaaaatcgtagttgagcctatcacaattccataaaattggcttgtgaggtgagcattactctcacttataaacacattgtcag 21427188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 137 - 171
Target Start/End: Original strand, 51460049 - 51460083
Alignment:
137 tcttagaaatggtggttgggcctaacacaacccca 171  Q
    |||||||||| ||||||||||||||||||||||||    
51460049 tcttagaaattgtggttgggcctaacacaacccca 51460083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 139 - 217
Target Start/End: Original strand, 52215127 - 52215205
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| |||| |||  |||||||||||||||||||  || ||||| ||||| | || |||| ||||||||||||||    
52215127 ttagaaatcgtggatggatctaacacaaccccacaaaactggattgtgcggtgaagattcccccgacttataaacacat 52215205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 8750023 - 8749966
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    ||||||||||| ||||||  | |||||||| | |||||||||||||||| ||||||||    
8750023 tcttagaaatgatggttgaacataacacaatctcacaaaatcggcttgtaaggtgagg 8749966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 12509511 - 12509548
Alignment:
157 cctaacacaaccccacaaaatcggcttgtgaggtgagg 194  Q
    |||||||||| ||||||||| |||||||||||||||||    
12509511 cctaacacaaacccacaaaaccggcttgtgaggtgagg 12509548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 35303504 - 35303557
Alignment:
202 ccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||| ||||||||||  ||| | |||||||||||| |||||||||||    
35303504 ccacttataaatacattgtcagatcatgttctatccgatgtgggactcttaaca 35303557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 186
Target Start/End: Complemental strand, 49868693 - 49868644
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtg 186  Q
    |||||||||| ||||||||| || ||| ||||||||||||||||| ||||    
49868693 tcttagaaattgtggttgggtcttacataaccccacaaaatcggcatgtg 49868644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 137 - 177
Target Start/End: Complemental strand, 2120162 - 2120122
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaat 177  Q
    |||||||||| ||| |||| |||||||||||||||||||||    
2120162 tcttagaaatcgtgattggacctaacacaaccccacaaaat 2120122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 179 - 255
Target Start/End: Complemental strand, 4000320 - 4000245
Alignment:
179 ggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||| |||||||  |||  ||||||||||||||||||||||| || | ||| |||| ||||| |||||||||||    
4000320 ggcttgtaaggtgagaattgttcccacttataaacacattgtcagaccttatcc-atccaatgtgagactcttaaca 4000245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 22100105 - 22100053
Alignment:
199 cccccacttataaacacattgtcaggccatctcctatccgatgtgtgactctt 251  Q
    |||||||||||||||||||||||||| |||||  |||| |||||  |||||||    
22100105 cccccacttataaacacattgtcaggtcatctaatatcggatgtaggactctt 22100053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 149 - 217
Target Start/End: Complemental strand, 26229641 - 26229573
Alignment:
149 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||||| ||||||||||||| | |||  || ||| |||||||||| |||||  |||||||||||||||    
26229641 tggttggacctaacacaaccctaaaaatccgacttatgaggtgaggattgccttcacttataaacacat 26229573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 203 - 239
Target Start/End: Complemental strand, 42819319 - 42819283
Alignment:
203 cacttataaacacattgtcaggccatctcctatccga 239  Q
    ||||||||||||||||||||| ||||||| |||||||    
42819319 cacttataaacacattgtcagaccatctcttatccga 42819283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 49142798 - 49142746
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtga 192  Q
    |||||||||||||||  |||||| |||| |||||||| |||||||| ||||||    
49142798 tagaaatggtggttgaacctaactcaactccacaaaaccggcttgtaaggtga 49142746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 88; Significance: 5e-42; HSPs: 1)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 141 - 256
Target Start/End: Complemental strand, 6355 - 6240
Alignment:
141 agaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgat 240  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||| |||| |||    
6355 agaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttatctgat 6256  T
241 gtgtgactcttaacac 256  Q
    ||| ||||||||||||    
6255 gtgggactcttaacac 6240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 78; Significance: 5e-36; HSPs: 2)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 137 - 254
Target Start/End: Original strand, 5753 - 5870
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||| | || || ||||    
5753 tcttagaaatcgtggttgggcctaacacaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcagactatgtcttatc 5852  T
237 cgatgtgtgactcttaac 254  Q
    ||||||| ||||||||||    
5853 cgatgtgggactcttaac 5870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 137 - 222
Target Start/End: Original strand, 5543 - 5628
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    ||||||||||  |||||||||||||||||||||| ||||| |||||||||| |||||| |||||||||||||||||||||||||||    
5543 tcttagaaattatggttgggcctaacacaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtca 5628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 75; Significance: 3e-34; HSPs: 2)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 243
Target Start/End: Complemental strand, 14388 - 14282
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||  ||||||||||||||||||||||||||||| ||||||||||||||| | ||| |||||||||||||||||||||||| ||||| ||||||    
14388 tcttagaaaacgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcagaccatcacctatc 14289  T
237 cgatgtg 243  Q
    |||||||    
14288 cgatgtg 14282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 200 - 254
Target Start/End: Complemental strand, 14560 - 14506
Alignment:
200 ccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    |||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||    
14560 ccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaac 14506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 75; Significance: 3e-34; HSPs: 2)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 5740 - 5622
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||| ||||||||||||||||||| |||||||| || ||||| || |||||||||||||||||||||||| ||||||| |||||    
5740 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattacccccacttataaacacattgtcatgccatcttctatc 5641  T
237 cgatgtgtgactcttaaca 255  Q
     |||||| |||||||||||    
5640 tgatgtgggactcttaaca 5622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 135 - 256
Target Start/End: Complemental strand, 5977 - 5856
Alignment:
135 attcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||||||||| || ||||| ||||||||||||  ||||||||||||||  |||||||| ||| || |||||||||||| ||||||| ||||||| |||    
5977 attcttagaaatcgtagttggacctaacacaacctaacaaaatcggcttgaaaggtgaggattgtcctcacttataaacatattgtcatgccatcttcta 5878  T
235 tccgatgtgtgactcttaacac 256  Q
    |||||||||  ||| |||||||    
5877 tccgatgtggaactgttaacac 5856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 74; Significance: 1e-33; HSPs: 1)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 140 - 257
Target Start/End: Original strand, 4431 - 4548
Alignment:
140 tagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccga 239  Q
    |||||||  |||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| | ||    
4431 tagaaatcatggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactga 4530  T
240 tgtgtgactcttaacacc 257  Q
    ||||  ||||||||||||    
4531 tgtggcactcttaacacc 4548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 72; Significance: 2e-32; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 139 - 253
Target Start/End: Complemental strand, 3928 - 3813
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||| ||||||| |||||||||||||||||||||  |||||||||||||||| ||| ||||||||||| |||||||||||||||||||  ||||||    
3928 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatcc 3829  T
238 gatgtgtgactcttaa 253  Q
    |||||| |||||||||    
3828 gatgtgggactcttaa 3813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 72; Significance: 2e-32; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 139 - 253
Target Start/End: Complemental strand, 4572 - 4457
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttg-cccccacttataaacacattgtcaggccatctcctatcc 237  Q
    |||||||| ||||||| |||||||||||||||||||||  |||||||||||||||| ||| ||||||||||| |||||||||||||||||||  ||||||    
4572 ttagaaattgtggttgtgcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatcc 4473  T
238 gatgtgtgactcttaa 253  Q
    |||||| |||||||||    
4472 gatgtgggactcttaa 4457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 69; Significance: 1e-30; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 56542 - 56426
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||| || ||||||||| ||||||||  || |||||| |||    
56542 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccg 56443  T
239 atgtgtgactcttaaca 255  Q
    ||||| |||||||||||    
56442 atgtgggactcttaaca 56426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 288656 - 288770
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||||||||  ||||||||||||||||||| |||||||| | ||||||||||||||| |||| ||||  |||||| |||||||||| ||||||||||||    
288656 tcttagaaatcatggttgggcctaacacaactccacaaaaccagcttgtgaggtgaggattgcgcccagatataaatacattgtcagaccatctcctatc 288755  T
237 cgatgtgtgactctt 251  Q
    ||||||| |||||||    
288756 cgatgtgggactctt 288770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 67; Significance: 2e-29; HSPs: 2)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 81927 - 81809
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| || ||||| ||||||   ||| ||||||||||||||| ||||||||||||| | || ||    
81927 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtaaggtgaaaattgtccccacttataaacatattgtcaggccatgttctgtc 81828  T
237 cgatgtgtgactcttaaca 255  Q
    ||||||| |||||||||||    
81827 cgatgtgggactcttaaca 81809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 137 - 256
Target Start/End: Complemental strand, 82161 - 82042
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| ||||||||||||||||||||||||||||| ||| |||| |  ||||| || |||||| ||||| ||||||||||||||||| || | ||    
82161 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggtttgtaatttgaggatttcccccatttatatacacattgtcaggccatgtcatgtc 82062  T
237 cgatgtgtgactcttaacac 256  Q
     |||||| ||||||||||||    
82061 tgatgtgggactcttaacac 82042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 66; Significance: 7e-29; HSPs: 2)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 3472 - 3589
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||| ||||| ||||||||||||||||||| ||||||||||||||| | ||| ||||||||||||||| ||||||| | || |||||| |||    
3472 ttagaaatcgtgattgggtctaacacaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaacaaattgtcatgtcaactcctaaccg 3571  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
3572 atgtgggactcttaacac 3589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 139 - 256
Target Start/End: Original strand, 3241 - 3355
Alignment:
139 ttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccg 238  Q
    |||||||| ||||||| | ||||||||| |  |||||| ||||||||||| |||||    || ||||||||||||| ||| || ||||| ||||||  ||    
3241 ttagaaatcgtggttgtgtctaacacaatcttacaaaaccggcttgtgagatgagga---cctccacttataaacaaattatctggccaactcctaatcg 3337  T
239 atgtgtgactcttaacac 256  Q
    ||||| ||||||||||||    
3338 atgtgagactcttaacac 3355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 66; Significance: 7e-29; HSPs: 2)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 137 - 254
Target Start/End: Complemental strand, 12732 - 12615
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| ||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||| |||||| |||||||||  ||||| ||||||    
12732 tcttaaaaattgtggttgggcctaacacaaccacacaaaatcgacttgtgaggtgaggattgcccccacatataaatacattgtcaaaccatcacctatc 12633  T
237 cgatgtgtgactcttaac 254  Q
    |||  || ||||||||||    
12632 cgacatgggactcttaac 12615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 159 - 256
Target Start/End: Complemental strand, 12944 - 12847
Alignment:
159 taacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||  | |||| ||| |||| || ||||| |||||||||||||||||  |||||||| |||||| ||||| ||||||| | ||||||||||    
12944 taacacaacctgataaaaccggtttgtaagatgaggattgcccccacttataaattcattgtcaagccatcacctattcgatgtggggctcttaacac 12847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: scaffold0181
Description:

Target: scaffold0181; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 137 - 255
Target Start/End: Complemental strand, 21024 - 20906
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    |||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||| || ||  |||||||||| |||||||||| |||||||||  |    
21024 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattaccttcacttataaatacattgtcagaccatctccttac 20925  T
237 cgatgtgtgactcttaaca 255  Q
     |||||  |||||||||||    
20924 tgatgtcagactcttaaca 20906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 136 - 256
Target Start/End: Complemental strand, 121640 - 121519
Alignment:
136 ttcttagaaatggtggttgggcctaacacaa-ccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctccta 234  Q
    |||||| |||| |||||||||| |||||||| |||||||||| |||||||||| | |||| | ||||||||||| ||||||||||||| | |||| ||||    
121640 ttcttaaaaatcgtggttgggcttaacacaaaccccacaaaaccggcttgtgatgggaggatggcccccacttacaaacacattgtcatgtcatcaccta 121541  T
235 tccgatgtgtgactcttaacac 256  Q
    ||||||||  ||||||||||||    
121540 tccgatgtaggactcttaacac 121519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 162 - 254
Target Start/End: Original strand, 69557 - 69649
Alignment:
162 cacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    |||||||||| |||| ||| ||||||||||||| ||||||||||||||||||| ||||||||||||| | ||||||| |||| ||||||||||    
69557 cacaaccccataaaaccggtttgtgaggtgaggattgcccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac 69649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0417 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0417
Description:

Target: scaffold0417; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 459 - 580
Target Start/End: Original strand, 12705 - 12826
Alignment:
459 ttgaaggaatttgtgtagcaaggagctgtacttttagaagataaatgaggttttaatcttgcttcaccaacaaaacctaaaccagaagcaggtgcaggtc 558  Q
    ||||||| |||||| || ||||||  ||| ||||||| |||||||| |||| |||||||||||||||||||  |||||||||||||| ||| || || ||    
12705 ttgaagggatttgtataccaaggaattgtccttttagtagataaatcaggtgttaatcttgcttcaccaactgaacctaaaccagaaccagctggagatc 12804  T
559 tatccaaaacagaagtcattac 580  Q
     |||||||| ||||||||||||    
12805 catccaaaaaagaagtcattac 12826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 137 - 222
Target Start/End: Complemental strand, 51321 - 51236
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtca 222  Q
    |||||||||| ||| ||| || ||||||||||||||||||  | |||||||||||||| |||||||||||||||||||||||||||    
51321 tcttagaaattgtgattgagcataacacaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaacacattgtca 51236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 154 - 255
Target Start/End: Complemental strand, 20643 - 20542
Alignment:
154 gggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaa 253  Q
    ||||||||| || ||  |||||| | |||||| |||||||| ||||||||| ||||||||||||||||||||||| |||| ||||||||| |||||||||    
20643 gggcctaactcatccttacaaaaccagcttgtaaggtgaggattgcccccaattataaacacattgtcaggccatatcctgtccgatgtgggactcttaa 20544  T
254 ca 255  Q
    ||    
20543 ca 20542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 197 - 254
Target Start/End: Complemental strand, 429898 - 429841
Alignment:
197 tgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaac 254  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||    
429898 tgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac 429841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 49; Significance: 1e-18; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 67570 - 67490
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    ||||| |||| |||||||| || |||||||| |||||||||||| |||| |||||||| ||||||||||||||||||||||    
67570 tcttaaaaattgtggttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 67490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 67363 - 67283
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||| | ||| ||| ||||||||||| |||| |||| | ||||||||||||| | ||||||||||||||||||||||    
67363 tcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat 67283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 2)
Name: scaffold0459
Description:

Target: scaffold0459; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 13373 - 13299
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| |||| | |||||| |||||||||||||||| ||| ||||| |||||| |||||||||||||    
13373 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacac 13299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 178 - 242
Target Start/End: Complemental strand, 13145 - 13081
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||||||||||||| | ||||||||||||| ||||| ||||| || ||||| ||||||||||||    
13145 cggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt 13081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 4)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 11014 - 10940
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| |||| | |||||| |||||||||||||||| ||| ||||| |||||| |||||||||||||    
11014 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacac 10940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 14680 - 14606
Alignment:
182 ttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||||||||| |||| | |||||| |||||||||||||||| ||| ||||| |||||| |||||||||||||    
14680 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaacac 14606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 178 - 242
Target Start/End: Complemental strand, 10786 - 10722
Alignment:
178 cggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    ||||||||||||||| | ||||||||||||| ||||| ||||| || ||||| ||||||||||||    
10786 cggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt 10722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 181 - 242
Target Start/End: Complemental strand, 14449 - 14388
Alignment:
181 cttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatccgatgt 242  Q
    |||||||||||| | ||||||||||||| ||||| |||||||| || || ||||||||||||    
14449 cttgtgaggtgatgattgcccccacttacaaacatattgtcagaccgtcacctatccgatgt 14388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 89552 - 89671
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacattgtcaggccatctcctatc 236  Q
    ||||| |||| |||||||| |||||||||||| ||||||| || ||||| ||||||   ||| ||||||||||||||| ||| ||||  ||| || ||||    
89552 tcttaaaaattgtggttggacctaacacaacctcacaaaaccgacttgtaaggtgaatattgtccccacttataaacatattatcagatcatatcttatc 89651  T
237 cgatgtgtgactcttaacac 256  Q
    ||||  | ||||||||||||    
89652 cgatcggggactcttaacac 89671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 347570 - 347648
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacac 215  Q
    |||||||| | || ||||||||||| |||||||||||||| ||||||||||||| | |  |||||||| ||||||||||    
347570 tcttagaattcgtagttgggcctaatacaaccccacaaaaccggcttgtgaggtaaagactgcccccaattataaacac 347648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: scaffold0729
Description:

Target: scaffold0729; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 158 - 255
Target Start/End: Complemental strand, 2575 - 2476
Alignment:
158 ctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccactt-ata-aacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||| |||||  |||||| ||||||||||||||||| ||| | || ||| ||| ||| |||||||||||||| || ||||||||||| |||||||||||    
2575 ctaactcaaccttacaaaaccggcttgtgaggtgaggattgtctcctctttatanaactcattgtcaggccatgtcatatccgatgtgggactcttaaca 2476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 206 - 256
Target Start/End: Complemental strand, 2745 - 2695
Alignment:
206 ttataaacacattgtcaggccatctcctatccgatgtgtgactcttaacac 256  Q
    ||||||| | |||||||| |||| |||||||||||||| ||||||||||||    
2745 ttataaatatattgtcagaccatgtcctatccgatgtgggactcttaacac 2695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 217
Target Start/End: Original strand, 41205 - 41284
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagggttgcccccacttataaacacat 217  Q
    |||||||||| || |||| |||||| |||||||||||||||||| | ||||| | ||| ||| || |||||||||||||||    
41205 tcttagaaatcgtagttgagcctaatacaaccccacaaaatcgg-tagtgagattaggattgtccacacttataaacacat 41284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1034 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1034
Description:

Target: scaffold1034; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 196 - 255
Target Start/End: Complemental strand, 3262 - 3203
Alignment:
196 ttgcccccacttataaacacattgtcaggccatctcctatccgatgtgtgactcttaaca 255  Q
    ||||||||||||||||||| || || |||||| |||||| |||||||  |||||||||||    
3262 ttgcccccacttataaacaaatagtaaggccaactcctaaccgatgtaggactcttaaca 3203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0211 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0211
Description:

Target: scaffold0211; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 190
Target Start/End: Original strand, 24633 - 24686
Alignment:
137 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtgaggt 190  Q
    |||||||| | |||||||||| ||| ||||| ||| ||||||||||||||||||    
24633 tcttagaatttgtggttgggcttaatacaacgccataaaatcggcttgtgaggt 24686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University