View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4741_low_5 (Length: 506)
Name: NF4741_low_5
Description: NF4741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4741_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 351 - 489
Target Start/End: Original strand, 2601217 - 2601350
Alignment:
| Q |
351 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatcatacccctcattgtatatt |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||| |
|
|
| T |
2601217 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatcgtacc-----ttatatatt |
2601311 |
T |
 |
| Q |
451 |
tatgtgtcatttatgatttattactaatctttatattgt |
489 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2601312 |
tatgtgtcaattatgatttattactaatctttatattgt |
2601350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 428 - 489
Target Start/End: Original strand, 2614769 - 2614830
Alignment:
| Q |
428 |
aatcatacccctcattgtatatttatgtgtcatttatgatttattactaatctttatattgt |
489 |
Q |
| |
|
||||||||||||| | ||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2614769 |
aatcatacccctcgtcgtatatttacgtgtcatttatgatttgttactaatctttatattgt |
2614830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 426
Target Start/End: Original strand, 2614680 - 2614748
Alignment:
| Q |
351 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaa |
426 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
2614680 |
ttaattaacatctatcggctttgctttgg-----tgtcatgtttctaccatattga--ctagtaagataaaatgaa |
2614748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 401 - 475
Target Start/End: Complemental strand, 22199234 - 22199163
Alignment:
| Q |
401 |
tattgactctagtaagataaaatgaataatcatacccctcattgtatatttatgtgtcatttatgatttattact |
475 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
22199234 |
tattgactctagtaaga--aaatgaataatcatacccctcgttgtatatttatgtgtca-ttatgatttattact |
22199163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University