View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4742_high_4 (Length: 374)
Name: NF4742_high_4
Description: NF4742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4742_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 33 - 366
Target Start/End: Original strand, 23332595 - 23332928
Alignment:
| Q |
33 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
132 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
133 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
| Q |
233 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcat |
332 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctgtttggatcacgcaacatgacataatcat |
23332894 |
T |
 |
| Q |
333 |
caacatgcacaccatattccttggcgaaacacga |
366 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23332895 |
caacatgcaaaccatattccttggcgaaacacga |
23332928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 354
Target Start/End: Complemental strand, 10955166 - 10955074
Alignment:
| Q |
260 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcatcaacatgcacaccatattcctt |
354 |
Q |
| |
|
|||||||| || ||| ||||||||| |||||||||||||| |||| |||||||||| |||||||| |||||||| |||| |||||||||||| |
|
|
| T |
10955166 |
accttgcccttcttcttgtggaccttaacctcgaacatgttcttgttaggatcacgca--atgacatagtcatcaacgtgcaaaccatattcctt |
10955074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 260 - 327
Target Start/End: Original strand, 2027692 - 2027759
Alignment:
| Q |
260 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacata |
327 |
Q |
| |
|
||||||||||||||| ||| || || ||||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
2027692 |
accttgccatttttcttgtgaactttaacctcaaacatgttcttgtttggatcacgcaaaatgacata |
2027759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University