View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4742_low_1 (Length: 221)
Name: NF4742_low_1
Description: NF4742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4742_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 2564876 - 2564683
Alignment:
| Q |
10 |
catcatcaaattggtcattaaaatcagggcctccaacaatagcacccacatgaatattaggatttggatcagaggaatagaaataatctgtgtaaccatc |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2564876 |
catcattaaattggtcattaaaatcagggcctccaactatagcacccacatgaatattaggatttggattagaggaatagaaataatctgtgtaaccatc |
2564777 |
T |
|
| Q |
110 |
attgcaacccactttggtctggtgaagtttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564776 |
attgcaacccactttggtctggtgaactttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
2564683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 2574761 - 2574577
Alignment:
| Q |
19 |
attggtcattaaaatcagggcctccaacaatagcacccacatgaatattaggatttggatcagaggaatagaaataatctgtgtaaccatcattgcaacc |
118 |
Q |
| |
|
||||||||||| ||| || |||||||||||||||||||||||||||||||||||||||| ||| || ||||||| | | | |||||||||||||| |
|
|
| T |
2574761 |
attggtcattagaatttggtcctccaacaatagcacccacatgaatattaggatttggattagatgatgagaaatagttcgattggccatcattgcaacc |
2574662 |
T |
|
| Q |
119 |
cactttggtctggtgaagtttgattgaagggatggaagaacctctgtgatgtaattgctttggatatttacttccatatcccacc |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
2574661 |
cactttggtctggtgaactttgattgaagggatggaagaacctctgtgatgtaattgttttggatatttactcccatatcccacc |
2574577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University