View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4743-Insertion-11 (Length: 221)
Name: NF4743-Insertion-11
Description: NF4743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4743-Insertion-11 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 72 - 221
Target Start/End: Original strand, 34946688 - 34946837
Alignment:
| Q |
72 |
ggcatcatgctaactgttgtatgatatataccttgagcgaaacagcatcagcttgagggatggatttaaacatgttcccaccaacaaaactcaagttatt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946688 |
ggcatcatgctaactgttgtatgatatataccttgagcgaaacagcatcagcttgagggatggatttaaacatgttcccaccaacaaaactcaagttatt |
34946787 |
T |
|
| Q |
172 |
ggttcctgttaaacctgaaacaacctgtggaaggtccaggacaatgtact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946788 |
ggttcctgttaaacctgaaacaacctgtggaaggtccaggacaatgtact |
34946837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 34951184 - 34951308
Alignment:
| Q |
97 |
atataccttgagcgaaacagcatcagcttgagggatggatttaaacatgttcccaccaacaaaactcaagttattggttcctgttaaacctgaaacaacc |
196 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||| || | ||||||||||| ||||||||| |
|
|
| T |
34951184 |
atataccttgagcaaaacggtatcagcttgagggatagatttaaacatgttcccaccaacaaaactcaagttaatgctccctgttaaacccgaaacaacc |
34951283 |
T |
|
| Q |
197 |
tgtggaaggtccaggacaatgtact |
221 |
Q |
| |
|
||||||||||||| |||| |||||| |
|
|
| T |
34951284 |
tgtggaaggtccaagacagtgtact |
34951308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 34946627 - 34946668
Alignment:
| Q |
9 |
tttcaatctgaaatatcggttcatagagtattagatgtaatt |
50 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34946627 |
tttcaatctgaaatatcggttcatatagtattagatgtaatt |
34946668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 164
Target Start/End: Original strand, 8074617 - 8074682
Alignment:
| Q |
99 |
ataccttgagcgaaacagcatcagcttgagggatggatttaaacatgttcccaccaacaaaactca |
164 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||| ||||||||| || || |||||||||| |
|
|
| T |
8074617 |
ataccttgagtaaaattgcatcagcttgagggatagattcaaacatgtttccgcctacaaaactca |
8074682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University