View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4743-Insertion-9 (Length: 261)
Name: NF4743-Insertion-9
Description: NF4743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4743-Insertion-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 45318845 - 45319098
Alignment:
| Q |
8 |
ggaataactatcacaaaaggtccggctaagattctttcacgttatcttcgtgatcgtgcgagttcctgccatgatttatgcaaatatggtattcagcatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318845 |
ggaataactatcacaaaaggtccggctaagattctttcacgttatcttcgtgatcgtgcgagttcctgccatgatttatgcaaatatggtattcagcatg |
45318944 |
T |
 |
| Q |
108 |
ccactgaaacaaaaccatggattacatcacagaaaaggagggaaaggaaaaccaatgtttcaggagaaattgtaatttcgttggaagggacaaagaaatc |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318945 |
ccactgaaacaaaaccatggagtacatcacagaaaaggagggaaaggaaaaccaatgtttcaggagaaattgtaatttcgttggaagggacaaagaaatc |
45319044 |
T |
 |
| Q |
208 |
aagaagaagttcaaatgcttctcctctagcttcaaaacatgcagatcccaacta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45319045 |
aagaagaagttcaaatgcttctcctctagcttcaaaacatgcagatcccaacta |
45319098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University