View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744-Insertion-12 (Length: 207)
Name: NF4744-Insertion-12
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744-Insertion-12 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 76 - 207
Target Start/End: Original strand, 9480046 - 9480181
Alignment:
| Q |
76 |
gaatatatggtccaatatttcctacaaa----acgacatcgaaattgtgttttcttcccaatcaagaagaaaattaagagagcaatgataaattgttaca |
171 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
9480046 |
gaatatatggtccaatattgcctacaaattaaacgacatcgaaattgtgttttcttcctaattaagaagaaaattatgagagtaatgataaattattaca |
9480145 |
T |
 |
| Q |
172 |
tatttgatttgacctccttgtgttttcttcttccca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9480146 |
tatttgatttgacctccttgtgttttcttcttccca |
9480181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 9480005 - 9480044
Alignment:
| Q |
16 |
atataatactgttatttgtcgtaggtggttaccttgccat |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9480005 |
atatgatactgttatttgtcgtaggtggttaccttgccat |
9480044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University