View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744-Insertion-13 (Length: 200)
Name: NF4744-Insertion-13
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744-Insertion-13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 38299709 - 38299517
Alignment:
| Q |
8 |
gtcaggaggaggcaaaacaatatcttgacataaccactccatgatgttcttcattgagtcgtactcgcaatgacgaaaggaataatcagatgaaaggatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299709 |
gtcaggaggaggcaaaacaatatcttgacttaaccattccatgatgttcttcattgagtcgtactcgcaatgacgaaaggaataatcagatgaaaggatc |
38299610 |
T |
 |
| Q |
108 |
atggatgcacaagtttttactaaccgtgatatcttttgctccattgtctcgttatcagagtccagtaaatctaccgcgcaatcggattccata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38299609 |
atggatgcacaagtttttactaaccgtgattccttttgctccattgtctcgtcatcagagtccagtaaatctacctcgcaatcggattccata |
38299517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University