View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4744_high_14 (Length: 212)

Name: NF4744_high_14
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4744_high_14
NF4744_high_14
[»] chr2 (2 HSPs)
chr2 (90-196)||(44565117-44565223)
chr2 (91-171)||(36035895-36035975)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 90 - 196
Target Start/End: Original strand, 44565117 - 44565223
Alignment:
90 ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44565117 ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt 44565216  T
190 gggtctc 196  Q
    |||||||    
44565217 gggtctc 44565223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 91 - 171
Target Start/End: Complemental strand, 36035975 - 36035895
Alignment:
91 tgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactaca 171  Q
    |||||||||||||||| |||||||||||| |||| ||| ||| ||||||  ||||||||||| ||||||||||||||||||    
36035975 tgttatctgatgtgttagtggctataggaggaaattgctgcagtggtatcaactgtgctctttgtgtctggagtgactaca 36035895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University