View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744_low_1 (Length: 704)
Name: NF4744_low_1
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744_low_1 |
 |  |
|
| [»] scaffold0066 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 176; Significance: 2e-94; HSPs: 4)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 329 - 512
Target Start/End: Complemental strand, 32800 - 32617
Alignment:
| Q |
329 |
atttttatcatttcactcatgtcacttctggacagagcttattggcggttagtactacaaagtatgtttgcagtgtttattaaataattccggcattgcc |
428 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32800 |
atttttatcatttcactcatttcacttctggacagagcttattggcggttagtactacaaagtatgtttgcagtgtttattaaataattcaggcattgcc |
32701 |
T |
 |
| Q |
429 |
tctagttatttctgtccaagaacaaactacattcaaacaataaaatttgaaagtaccatcaattcgtggtagtgcaatggctcc |
512 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32700 |
tctagttatttctgtccaagaacaaactacattcaaacaataaaatttgaaagtaccatcaattcgtggtagtgcaatggctcc |
32617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 575 - 682
Target Start/End: Complemental strand, 32554 - 32447
Alignment:
| Q |
575 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgtttatacaaaaaacgcttaaacttgaaacccaagtttac |
674 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32554 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgttaatacaaaaaacgcttaaacttgaaacccaagtttac |
32455 |
T |
 |
| Q |
675 |
ttgtatct |
682 |
Q |
| |
|
|||||||| |
|
|
| T |
32454 |
ttgtatct |
32447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 23 - 145
Target Start/End: Complemental strand, 33099 - 32979
Alignment:
| Q |
23 |
ctcctatcagaagatgcagaagcaggactaagattttcttcttttgggatgaaagatgaaaaaccgattgaaaatctgatcttatacgcgcccgcctcct |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
33099 |
ctcctatcagaaaatgcagaagcaggactaaggtttt--tcttttgggatgaaagatgaaaaactgattgaaaatctgatcttatacgcgccttcctcct |
33002 |
T |
 |
| Q |
123 |
tcgttttgtcttcaaccagcgta |
145 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33001 |
tcgttttgtcttcaaccagcgta |
32979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #4
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 195 - 255
Target Start/End: Complemental strand, 32934 - 32874
Alignment:
| Q |
195 |
gttagtcacggttaaaataaaagtgtggcaattatagcttaccttatctttctatccaaac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32934 |
gttagtcacggttaaaataaaagtgtggcaattatagcttaccttatctttctatccaaac |
32874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University