View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744_low_12 (Length: 234)
Name: NF4744_low_12
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744_low_12 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 105 - 212
Target Start/End: Complemental strand, 32554 - 32447
Alignment:
| Q |
105 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgtttatacaaaaaacgcttaaacttgaaacccaagtttac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32554 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgttaatacaaaaaacgcttaaacttgaaacccaagtttac |
32455 |
T |
 |
| Q |
205 |
ttgtatct |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
32454 |
ttgtatct |
32447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University