View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744_low_14 (Length: 225)
Name: NF4744_low_14
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 199
Target Start/End: Original strand, 34687 - 34877
Alignment:
| Q |
10 |
tgattttttatttgtctaaataacttgtgtgaaaaaggtaataatttatcctttaatatccatccattgaacaaacacgggcttattatacaaattttat |
109 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34687 |
tgattttttatttgtctaaataacttttgtgaaaaaggtaataatttatccttcaatatccatccattgaacaaacacgggcttattatacaaattttat |
34786 |
T |
|
| Q |
110 |
ttacccttgt-nnnnnnngtaaagaaataacttttatgtatacggagagagtggtggcgtgaagaggtgaaggaaggaatagcgaatatgc |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34787 |
ttacccttgtaaaaaaaagtaaagaaataacttttatgtatacggagagagtggtggcgtaaagaggtgaaggaaggaatagcgaatatgc |
34877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University