View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4744_low_19 (Length: 202)
Name: NF4744_low_19
Description: NF4744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4744_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 4e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 89 - 191
Target Start/End: Complemental strand, 38728475 - 38728373
Alignment:
| Q |
89 |
gtaccaacatgtcaagatgctcatctatggtgtttaatgtaaaaggacgtgtaggatttgttgatgagggtaggacattcttcacaccacatactttgat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38728475 |
gtaccaacatgtcaagatgctcatctatggtgtttaatgtaaaaggacttgtaggatttgttgatgagggtaggacattcttcacaccacatactttgat |
38728376 |
T |
|
| Q |
189 |
gat |
191 |
Q |
| |
|
||| |
|
|
| T |
38728375 |
gat |
38728373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 9 - 65
Target Start/End: Complemental strand, 38728559 - 38728499
Alignment:
| Q |
9 |
acatcatcaagtcaaaaata----tcaaaatgacttaagctacattataattttacgactg |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38728559 |
acatcatcaagtcaaaaataagaatcaaaatgacttaagctacattataattttacgactg |
38728499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University