View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745-Insertion-13 (Length: 474)
Name: NF4745-Insertion-13
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745-Insertion-13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 218 - 474
Target Start/End: Original strand, 26672282 - 26672534
Alignment:
| Q |
218 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagagaaggaaaccctagctaggaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26672282 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagagaaggaaaccctag----gaaa |
26672377 |
T |
|
| Q |
318 |
gaaagaagagaaggcgcgtggaatgagaatggcgcgtgtgtatgaggaaggataataaaaagaagagaagagaatgtagatgggttagggaatcacgaga |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672378 |
gaaagaagagaaggcgcgtggaatgagaatggcgcgtgtgtatgaggaaggataataaaaagaagagaagagaatgtagatgggttagggaatcacgaga |
26672477 |
T |
|
| Q |
418 |
aaatgatggatgtttagattccttcttccttccgacactgtgttttgttcagctctg |
474 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672478 |
aaatgatggatgtttagattccttcttccttccgacactgtgttttgttcagctctg |
26672534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 26672075 - 26672219
Alignment:
| Q |
8 |
catcactctttcttctaccactctttttcttgagagaatgcttaatcttggaagaaactttcttcttaagagaaccaccaccaccattactagaactacc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26672075 |
catcactctttcttctaccactctttttcttgagagaatgcttaatcttggaagaaactttcttcttaagaga---accaccaccattactagaactacc |
26672171 |
T |
|
| Q |
108 |
agaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672172 |
agaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
26672219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University