View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_high_25 (Length: 260)
Name: NF4745_high_25
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 32 - 244
Target Start/End: Complemental strand, 4075130 - 4074918
Alignment:
| Q |
32 |
ttacatcttcacttttcccttaattaagcatgttttccagcaagttgtgacacttaattgtaaattccatacctttcatgtagtaacttattttactgaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075130 |
ttacatcttcacttttcccttaattaagcatgttttccagcaagttgtgacacttaattgtaaattccatacctttcatgtagtaacttattttactgaa |
4075031 |
T |
 |
| Q |
132 |
aaggggcagctgacctaccaacactttaacgcccgtgcacccgaccatgcatttgttaagaacgcccgtgcatgatatatgcacggtttggcgccaattt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075030 |
aaggggcagctgacctaccaacactttaacgcccgtgcacccgaccatgtatttgttaagaacgcccgtgcatgatatatgcacggtttggcgccaattt |
4074931 |
T |
 |
| Q |
232 |
tgaagtggttcat |
244 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4074930 |
tgaagtggttcat |
4074918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University