View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_high_30 (Length: 240)
Name: NF4745_high_30
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 71 - 176
Target Start/End: Complemental strand, 26259623 - 26259524
Alignment:
| Q |
71 |
gcttatttggttttgacatcttttatctatatctatatctatagtatataacaaaccaactaactttttatttattgaggatatgtaggaattgcaatta |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26259623 |
gcttatttggttttgacatcttttatctatatctata------gtatataacaaaccagctaactttttatttattgaggatatgtaggaattgcaatta |
26259530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University