View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_high_9 (Length: 360)
Name: NF4745_high_9
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 32163127 - 32163480
Alignment:
| Q |
1 |
aatgtgtttactgttgggagtttggttacggcgtgtactaaattagggtgtttgcatcaagggaaatgggttcatgggtatgttattaagaatgggattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163127 |
aatgtgtttactgttgggagtttggttacggcgtgtactaaattagggtgtttgcatcaagggaaatgggttcatgggtatgttattaagaatgggattg |
32163226 |
T |
 |
| Q |
101 |
agattaattcttatttggctacttctcttttgaatatgtatgttaaatgtggtgatattggtgatgctcgttccgtgtttgatgaattttcagtttcgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163227 |
agattaattcttatttggctacttctcttttgaatatgtatgttaaatgtggtgatattggtgatgctcgttccgtgtttgatgaattttcagtttcgac |
32163326 |
T |
 |
| Q |
201 |
ttgtggtggtggtgacgatcttgttttttggacggctatgattgttgggtatactcagagaggttatcctcaagctgcgttggagttgtttaccgataag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163327 |
ttgtggtggtggtgacgatcttgttttttggacggctatgattgtcgggtatactcagagaggttatcctcaagctgcgttggagttgtttaccgataag |
32163426 |
T |
 |
| Q |
301 |
aaatggtataggattttgccaaattcagttactcttgcaagtttgctctctgct |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163427 |
aaatggtataggattttgccaaattcagttactcttgcaagtttgctctctgct |
32163480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 134 - 188
Target Start/End: Original strand, 42761122 - 42761176
Alignment:
| Q |
134 |
atatgtatgttaaatgtggtgatattggtgatgctcgttccgtgtttgatgaatt |
188 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42761122 |
atatgtatggtaaatgcggtgagattggtgatgctcgtaaggtgtttgatgaatt |
42761176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University