View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_13 (Length: 347)
Name: NF4745_low_13
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 343
Target Start/End: Original strand, 36536467 - 36536794
Alignment:
| Q |
16 |
aacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaatccttataaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536467 |
aacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaatccttataaatt |
36536566 |
T |
|
| Q |
116 |
acaagtttcttataaacttcatcacagtctttaaaagaattaatcggcaactcaatcttgctaataacattgtcaattgaattaaaagagataatcactt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536567 |
acaagtttcttataaacttcatcacagtctttaaaaggattaatcggcaactcaatcttgctaataacattgtcaattgaattaaaagagataatcactt |
36536666 |
T |
|
| Q |
216 |
catgactaaccttttcagttacctccatagcaatccaaaacaaggttccttccattgtcacattgttctcagtccaaaacaaatgtcccttcaaaatcaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536667 |
catgactaaccttttcagttacctccatagcaatccaaaacaaggttccttccattgtcacattgttctcagtccaaaacaaatgtcccttcaaaatcaa |
36536766 |
T |
|
| Q |
316 |
attttgatcacaacccttcatatctctc |
343 |
Q |
| |
|
|||||||||||||||||| || |||||| |
|
|
| T |
36536767 |
attttgatcacaaccctttatttctctc |
36536794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University