View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_2 (Length: 588)
Name: NF4745_low_2
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 469; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 469; E-Value: 0
Query Start/End: Original strand, 25 - 586
Target Start/End: Original strand, 39128505 - 39129070
Alignment:
| Q |
25 |
acccttgttttgtaattactacatgtctatttccatggtgtatatcattttgaactgtgtttatgctttgtgtcaacacaatagtatcactgtgtttatg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128505 |
acccttgttttgtaattactacatgtctatttccatggtgtttatcattttgaactgtgtttatgctttgtgtcaacacaatagtatcactgtgtttatg |
39128604 |
T |
|
| Q |
125 |
tttcattttgtttgaaatttccttaacaaggtttcatttttgtgtggtccgagtgaatgccatagttgagaaattgattttaagggttttgcttgtttca |
224 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128605 |
tttgattttgtttgaaatttccttaacaaggtttcatttttgtgtggtctgagtgaatgccatagttgagaaattgattttaagggttttgcttgtttca |
39128704 |
T |
|
| Q |
225 |
actatgttcaatttgaaaccaccaaataaacttatcaacattg----ttactactaggtgtttatgtttattcttattttcttttatctgttggcaatgt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128705 |
actatgttcaatttgaaaccaccaaataaacttatcaacattgttacttactaccaggtgtttatgtttattcttattttcttttatctgttggcaatgt |
39128804 |
T |
|
| Q |
321 |
atatatgttgttagagcggtggattctgttttcacttaactttgtttttcctgattagatttttaaatgtctattttcttggtgtttattgtttgtgttt |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39128805 |
atatatgttgttagagcggtggattctgttttcacttacctttgtttttcctgattagatttttaaatgtctattttcttggtgtttatcgtttgtgttt |
39128904 |
T |
|
| Q |
421 |
gcttttggaagtgtattgtagaagtttcttgaaggaagcttatttattgnnnnnnnnnnnnnnnncacaggcttttctttggtgtgaaggctactgttga |
520 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128905 |
gcttttggaagtgtattgtagaagtttcttgaaggaagcttatttattgttttttggttttttttcacaggcttttctttggtgtgaaggctactgttga |
39129004 |
T |
|
| Q |
521 |
aaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtgatggtgatgatgtccat |
586 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
39129005 |
aaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtggtggtgatgatggccat |
39129070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 508 - 574
Target Start/End: Complemental strand, 39496094 - 39496028
Alignment:
| Q |
508 |
aggctactgttgaaaaatgatttttaagggttctgataagtcaaagtactgtgctgttggtgatggt |
574 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
39496094 |
aggctaccgttgaaaaatggcttttaagggttctgataagtcaaagttctgtggtgttggtggtggt |
39496028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 84 - 133
Target Start/End: Original strand, 39128444 - 39128493
Alignment:
| Q |
84 |
tttatgctttgtgtcaacacaatagtatcactgtgtttatgtttcatttt |
133 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
39128444 |
tttatgctctgtgtcaatacaatagtatcactttgtttatgtttgatttt |
39128493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University