View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_26 (Length: 277)
Name: NF4745_low_26
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 20 - 160
Target Start/End: Complemental strand, 53493128 - 53492989
Alignment:
| Q |
20 |
ttgaatgcatttatgtatattgtaattattttatactcttgattagctagctatagagttgatgcaaaataaataaaatttctagttatttccaattggt |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53493128 |
ttgaatgcatttatgtatattgtacttattttatactcttgattagctagctatagagttgatgcaaaataaataaaatttctagttatttccaattggt |
53493029 |
T |
|
| Q |
120 |
gatgtttttgtttttggtgaaactacgctttcttcatacat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53493028 |
gatgtttttgtttttggtgaaactacgc-ttcttcatacat |
53492989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 20 - 149
Target Start/End: Complemental strand, 16072285 - 16072156
Alignment:
| Q |
20 |
ttgaatgcatttatgtatattgtaattattttatactcttgattagctagctatagagttgatgcaaaataaataaaatttctagttatttccaattggt |
119 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| | || ||||||| |||| |
|
|
| T |
16072285 |
ttgaatgcatttatatatattgtacttattttatactcttgattagctagctatggagttgatgcagaataaataaaatttatgattctttccaaatggt |
16072186 |
T |
|
| Q |
120 |
gatgtttttgtttttggtgaaactacgctt |
149 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| |
|
|
| T |
16072185 |
gatgttttagtttttggtaaaactacgctt |
16072156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 174 - 267
Target Start/End: Complemental strand, 53492941 - 53492848
Alignment:
| Q |
174 |
gctgagagttgctttcatatctcaaacaaatgtgcaggcnnnnnnngattcagaaataaataaaatgaatgttgagaactgctacttccctatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53492941 |
gctgagagttgctttcatatctcaaacaaatgtgcaggctttttttgattcagaaataaagaaaatgaatgttgagaactgctacttccctatg |
53492848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 174 - 263
Target Start/End: Complemental strand, 53500892 - 53500803
Alignment:
| Q |
174 |
gctgagagttgctttcatatctcaaacaaatgtgcaggcnnnnnnngattcagaaataaataaaatgaatgttgagaactgctacttccc |
263 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53500892 |
gctgagagttgctttcatatttcaaacaaatgtgcaggctttttttgattcagaaataaagaaaatgaatgttgagaactgctacttccc |
53500803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 174 - 267
Target Start/End: Complemental strand, 16072095 - 16072002
Alignment:
| Q |
174 |
gctgagagttgctttcatatctcaaacaaatgtgcaggcnnnnnnngattcagaaataaataaaatgaatgttgagaactgctacttccctatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||| ||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16072095 |
gctgagagttgctttcatatctcaaacaaatgtgcaggctttttttaatccagagataaagaaaatgaatgttgagagctgctacttccctatg |
16072002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University